Plant polyphenols in Chicory Roots are powerful disease fighters

Chicory root is the most talked about plant for its caffeine-replacing properties. Ground chicory root is used to make coffee as it contains no caffeine. In fact, it contains many nutritive compounds such as magnesium, vitamins, potassium, folic acid, calcium, iron, and many more. With no hint of caffeine and the exact same flavor of coffee, chicory root is the best substitute for caffeine coffee.

It offers health-promoting benefits for the heart, brain, digestion, metabolism, and the immune system. It acts as a natural remedy for age-related diseases like arthritis and kidney disease. All the credit goes to its powerful antioxidant capacity and plant polyphenols.

With the basic nutritional value out of the way, let’s discuss the science-backed benefits of chicory roots on human health.

1. Chicory Roots Provide Incredible Gastrointestinal Support

Chicory root is well known for its ability to relieve digestive problems. This is due to the good amount of insulin inulin content in chicory roots. A single serving of chicory root is plenty to help fight against all types of gastrointestinal diseases in humans.

That said, a study suggests the inulin improves gut health against obesity, diabetes, and other inflammatory diseases. A loss of nutritive dietary intake can put you at a higher risk of unabsorbed nutrients which might cause obesity and other diseases.

This study also proves that a versatile diet containing antioxidants, inulin, vitamins, and other nutrients can help control bacterial markers within the body. This instantaneously affects blood glucose levels, insulin production, and metabolic function. (1)

The use of inulin in increased absorption of iron can also help prevent gastrointestinal diseases, a study suggests. A study conducted on piglets proved that a sufficient intake of both iron and inulin, present in chicory roots, improved gastrointestinal tract function and physiological function. (2)

With inulin deficiency in the body, there’s very little iron absorption which has a direct negative impact on digestion. Higher iron and inulin concentration in the colon might decrease digestive acidity in the body.

Key Takeaway: The nutrients present in chicory root such as iron and inulin play a role in enhancing gastrointestinal function. It promotes proper nutrient absorption of iron and protein which reduces bloating, inflammation, and abnormal digestive function.

2. Chicory Roots Are A Great Substitute For Coffee

Do you know how to make chicory coffee? The health benefits of chicory coffee surpass all expectations. It’s considered to be good for fighting bacterial infections, supporting the liver, and fighting against oxidative stress.

I don’t need to tell you the effects of caffeine overdose, especially in adults with a weaker immune system. But I think it’s important to let you know that it can cause extreme alertness and restlessness when consumed in huge amounts. (3)

Having said that, chicory root contains powerful plant polyphenols that offer anti-inflammatory effects on the human body. A study conducted on 25 healthy participants concluded that an intake 300 ml of chicory root coffee on a daily basis decreased blood plasma concentration.

It didn’t have any effect on red blood cells or hematocrit levels which are essential for normal body function. On the other hand, it had a significant impact on reducing inflammatory markers in the body to prevent chronic diseases. (4)

Key Takeaway: Drinking 300 ml of chicory coffee everyday has been proved to be effective in treating inflammation in the bloodstream. It also reduces many types of proinflammatory diseases, bacterial infections, and oxidative stress in the body.

3. Chicory Roots Being A Low-Calorie Plant May Extend Lifespan

Low-calorie diets work in your favor to burn fat faster and strengthen the immune system. Recent studies have shed light on the positive effects of a low-calorie diet on reducing mortality rate in humans.

The metabolism-promoting benefits of chicory root due to its low-calorie count can help alleviate diseases such as obesity, heart disease, and diabetes.

In fact, in an animal study, it was concluded that the opposite diet of overeating is a low-calorie intake which restricts abnormal biochemical changes in the body.

Based on multiple tests, this study showed that calories restriction with the help of low-calorie foods has a more positive effect on metabolism and the immune system than other methods. This suppresses high glucose levels, brings lipid metabolism back to normal, and eliminates gut-microbial abnormalities. (5)

This study is closely related to another study conducted on animals with age-related diseases. The study concluded that a good intake of low-calorie foods can reduce mortality rate and combat chronic symptoms of aging such as memory loss, fragile bones, impaired vision, etc. (6)

Key Takeaway: Calories restriction with the help of low-calorie foods such as chicory root can alleviate the progression of age-related inflammation in humans. It supports both the biological and physiological function in humans.

4. Chicory Roots Contain Powerful Nutrients To Fight Osteoarthritis

Chicory roots have the kind of nutrients that can help treat osteoarthritis.

Being high in fiber and vitamin C, chicory roots fight against knee inflammation and stiff joints. A fiber-rich diet can lower your chances of suffering from painful knees. Osteoarthritis is caused due to noisy and painful knees.

So if you have painful knees, you’re at a higher risk of developing osteoarthritis as you get older. That’s why a proper intake of fiber and vitamin-rich diet is essential.

Having said that, a research studied the effects of dietary fiber on knee osteoarthritis. This attributed to its overall bone-strengthening properties. The concluded that people with very low fiber absorption in the body suffered from osteoarthritis. (7)

Additionally, a higher intake of fiber-rich foods, such as chicory root, showed a 30% lower risk of developing osteoarthritis.

The study on vitamin C showed that it plays a role in preventing painful knee osteoarthritis. People who consumed enough vitamin C in their diet showed an 11% lower risk of developing this condition than those who didn’t. (8)

Key Takeaway: Osteoarthritis is a painful condition that can be prevented, treated, and controlled with the help of a healthy diet. Chicory roots contain good amounts of fiber and vitamin C that can potentially decrease progression of painful knee osteoarthritis.

5. Chicory Roots Contain Plant Polyphenols That Prevent Oxidative Stress

Oxidative stress is caused by two primary reasons. The first is a significant reduction of the body’s antioxidant capacity and an increase in oxidant capacity. The second is a drastic increase in free radicals which leads to oxidative stress.

You can consume sufficient plant polyphenols to treat oxidative stress. This helps prevent the progression of many chronic diseases such as cancer, liver damage, heart disease, and metabolic syndrome.

A study on plant polyphenols concluded that it promotes antioxidant stability and protects the immune system against free radical-induced neurodegenerative diseases and diabetes. Once digested in the body, polyphenols are absorbed by colonic microflora and other intestinal enzymes.

This regulates the proper functioning of the digestive system while controlling certain abnormal cell processes that might cause oxidative stress. It is clear the polyphenols protect immune cells against oxidants and hence reduce the severe effects of free radical damage in the body. (9)

On an ending note, the consumption of chicory root for its high plant polyphenols capacity is also directly related to reducing proinflammatory effects of aging in the brain.

Key Takeaway: Chicory roots are good sources of polyphenols that are powerful antioxidants to prolong life span and overall health. They have been shown to reduce oxidative stress and inflammation. Both these factors play a role in fighting against cancer, heart disease, diabetes, and autoimmune disorders.

6. Chicory Roots Extract Suppresses Liver Damage

Chicory root extracts increase antioxidant capacity to fight hepatotoxicity-induced liver damage in rats. It even measured its powerful oxidative stress-reducing effects in male rats.

This research studied the body weight, hepatic lipid peroxidation, and molecular biomarkers of liver damage in rats. A regular consumption of chicory root extracts showed a significant change in boosting the antioxidant and free radical scavenging enzymes in the liver. (10)

This concludes that chicory root is rich in the kind of antioxidants that have a direct impact on liver health. The extracts supported the prevention of DNA damage caused by oxidative stress.

Another study proved that antioxidants play a role in promoting liver health. A number of antioxidants present in chicory root treat fibrosis and cirrhosis, both play a role in affecting oxidative stress in the liver.

Antioxidants stimulate the proper absorption of nutrients such as protein and fiber in the cells. This leads to reducing pro-oxidants count and reduces protein damage in the body. By decreasing the serious effects of liver damage, other factors such as DNA damage, production of cytokines, and reduction of epithelial cells prevented. (11)

Key Takeaway: Chicory roots may be beneficial for improving liver health. Due to its high antioxidant capacity, it reduces inflammation, cytokines, and oxidative stress in the liver.

7. Chicory Root Boosts Glucose And Lipid Metabolism In The Body

A research conducted to test the effects of chicory root on glucose and lipid metabolism concluded that chicory roots have favorable antihyperglycemic and antidyslipidemic effects on human health. (12)

These two factors play a role in affecting type 2 diabetes in humans. (13)

This controlled study took into account, 47 healthy individuals. A regular consumption of chicory root extracts for 4 weeks concluded that chicory root decreases high levels of lipid metabolism and improves overall bowel movements. This also prevents the development of diabetes in most humans.

People who digested chicory root extracts had better chances of fighting against hypertension and high LDL cholesterol levels too. This creates an effective foundation for fighting heart-related diseases.

While all these studies were positive, there was plenty of evidence on chicory root intake for both unhealthy and healthy adults. Compared to other foods, including coffee, the positive effects of chicory root extracts is directly associated with insulin production, glucose metabolism, and low-density lipoprotein cholesterol.

Key Takeaway: Chicory roots have several powerful properties that may benefit the heart and metabolic system. It prevents abnormal glucose and insulin levels while protecting against lipid metabolism in the body.

8. Chicory Roots Act As A Laxative To Prevent Chronic Constipation

There are a variety of foods that make great substitutes to laxative supplements to treat constipation. One of them is chicory root.

Using natural laxatives as a way to treat constipation can prevent the side-effects of laxative supplements in the body. These side-effects include inflammation, abnormal kidney and liver function, and dehydration. (14)

That said, chicory roots play a major role in relieving constipation due to its high inulin and fiber content.

The intake of dietary fiber is directly associated with improved gut health, fat metabolism, and proper immune function. It is also proved that fiber prevents accumulation of hard stools and eases the defecation process through the intestines. This prevents chronic constipation in most adults. (15)

This same study concludes that fiber effects gastrointestinal health by making stools softer and is more effective than laxative supplements for proper excretion of bacterial mass from the body.

Inulin, on the other hand, prevents constipation in elderly adults by improving bowel motor function. It increases fecal bacteria which is essential for proper defecation in adults. (16)

Key Takeaway: Multiple studies revealed that chicory root plays a role in the treatment of constipation in adults. It improves quality of stools and stimulates proper intestinal response to reducing defecation difficulties.

9. Chicory Roots Are An Excellent Source Of Vitamin B6

Vitamin B6 is commonly referred to as pyridoxine, which is a healthful compound for healthy nerve function, metabolism, and skin. Studies suggest that vitamin B6 also plays a role in detecting bacterial infections in the body.

To put into simple words, your body needs high vitamin B6 levels to determine bacterial infections such as food poisoning, malaria, and meningitis. The body’s immune cells, with the help of vitamin B6, trigger the body to fight against such bacterial infections. (17)

This research also concluded that the body’s MAIT cells use vitamin synthesis to trigger the immune system against bacteria and yeast infections. The folic acid present in chicory root also help alleviate bacterial infections in the body. It protects the inner linings of the intestines, mouth, and lungs.

On the other hand, a vitamin B6 deficiency in the body can mood swings, muscle swelling, fatigue, and worsen symptoms anemia. (18)

To improve levels of vitamin B6 in your diet, a daily consumption of 1.3 mg is considered normal for people below the age of 50. For people older than 50, a daily consumption of 1.7 mg is essential.

Key Takeaway: Chicory roots contain good amounts of vitamin B6 to prevent vitamin deficiency in the body. It plays a major role in defending the immune system against bacterial and yeast infections in the lungs, mouth, and other sensitive parts of the body.

10. The Prebiotics In Chicory Roots Strengthen The Immune System

Prebiotics are a form of fiber compound, but non-digestible in nature. Once digested, they pass through the digestive tract and break down in the colon with the help of the gut microflora. They have very similar health-promoting benefits like dietary fiber.

Higher intake of prebiotics, present in chicory roots, offers better digestive health, lower oxidative stress, and lower risk of developing obesity and diabetes. (19)

Moving forward, a research studied the positive effects of prebiotics, probiotics, and synbiotics on the human body. The result suggested that prebiotics has a significantly positive health effect on the body’s immunological functions such as autoimmune diseases, infections, and brain health. (20)

People with metabolic syndrome or bacterial strain can benefit from chicory roots consumption. It positively affects the epithelial cells, T regulatory cells, and natural killer T cells. All of these cells are important for proper regulation of the immune system.

Another study claims that prebiotics help reduce cytokines in the body. Cytokines are proinflammatory markers that directly affect the immune system to deteriorate. This can cause a host of chronic diseases including cancer. (21)

Key Takeaway: Prebiotics are known for their anti-inflammatory and antibacterial properties. Most studies conclude that increasing prebiotics intake can have a direct effect on the body’s immune system.

Discover 6 Amazing Chicory Root Recipes

The bitter taste of certain types of vegetables is not appreciated by most people. But at the same time, this particular flavor does an excellent job at balancing the sourness, saltiness, and sweetness of food. And one such vegetable is chicory roots.

The leafy greens are used to prepare all kinds of dishes, and not just coffee. Since they’re green and leafy, they are a perfect fit for salad mixes too. But there’s more, so let’s find out!

1. Sautéed Chicory Roots Salad

First, let’s learn how to prepare that perfect bright-colored sautéed chicory roots salad that everybody keeps talking about.

Ingredients:

1 onion or 2 shallots, sliced

1 head of leaf chicory

1 head of frisée

2 heads of Belgian endive

2 tbsp of minced garlic

2 tbsp of olive oil

1 oz of grated cheese, Parmigiano-Reggiano

1 cup of prunes, chopped

1/4 tsp of sea salt

1/3 cup of unsalted toasted walnuts, chopped

1/4 tsp of red pepper flakes or black pepper, freshly ground

Distilled vinegar

Method:

  1. Before beginning the cooking process, discard all the browned or wilted outer coverings of frisée, radicchio, and endive. Separate the remaining leaves of the veggies from their core before washing them in a mixture that contains a little bit of distilled vinegar and water. Then rinse the leaves using fresh water. Dry them on a cloth towel while blotting each one with a paper towel.
  2. Once the leaves are washed, rinsed, cleaned, and dried, it’s time to chop them. Make sure to keep the dense parts of the leaves away from the tender, delicate colored portions. This should give you several piles of chopped leaves.
  3. Now it’s time to cook. Take a skillet, pour oil in it and place it over medium heat. Add garlic and shallots. Sauté them for about 30 seconds before bringing in the white part of the chicory roots. Cook these until they become tender, which should not take more than 5 minutes. Following which add prunes and stir the whole thing for a minute.
  4. You can add the colored parts at this point. Then stir the leaves until they start to wilt, this will take another minute.
  5. After that, turn off the heat before adding the seasoning and walnuts. Fold the walnuts gently into the sautéed dish and transfer the ingredients to a salad serving dish. And that’s about it!

2. Chicory Gratin

This recipe is nothing but a simple yet rustic dish for family gatherings. And you can always eliminate the ham to transform it into a vegetarian meal.

Ingredients:

For chicory:

2 pinches of sea salt

1 tbsp of lemon juice

6 peppercorns, the white ones

4 heads of yellow chicory

1 tbsp of sugar

For chard:

2 stalks of Swiss chard with leaves, chopped

10g of unsalted butter

For cheese sauce:

1 tbsp of Dijon mustard

450ml of whole milk

A pinch of sea salt

35g of unsalted butter

A pinch of white pepper, freshly ground

25g of plain flour

100g of finely grated Comté cheese

For gratin:

50g of finely grated Comté cheese

4 slices of cooked ham

Method:

  1. First, let’s prepare the chicory. Take a saucepan and pour some water in it along with adding peppercorns, salt, sugar, and lemon juice. Place the pan on medium heat. Then cover it with a baking paper sheet and lid. Boil the solution, then simmer it for an hour. Cooking the chicory slowly helps in eliminating the leafy vegetable’s bitter taste.
  2. Then place the chicory on the wire rack. Let it drain as well as cool. Once that happens, gently press to get rid of any excessive moisture. You can use your tea towel for this purpose.
  3. Soon after, preheat your microwave to 190 degrees Celsius.
  4. Now it’s time to prepare the chard. For that, place butter and 100ml of water on a saucepan over high heat. Cook the Swiss chard stalks for at least 20 minutes. During this time, you can add water if required.
  5. Once they become tender, lift the stalks to replace them with leaves. Now you can cook them in that same saucepan with water for 3-5 minutes. Following which strain the leaves before mixing them with the stalks in a gratin dish.
  6. In the meantime, prepare the cheese sauce. Use another saucepan for this. Place it over medium heat to melt butter. Then add flour and whisk it properly until it becomes smooth in texture. Cook the paste for a while or until it turns nutty in color. Once that happens, turn off the heat.
  7. Now it’s time to bring in the milk. Whisk it thoroughly before turning on the heat back again. Cook the mixture for 4-5 minutes. Make sure that you keep stirring it in order to thicken the sauce.
  8. Then bring in the mustard and cheese and cook it for another 3 minutes. Once the cheese melts completely, turn off the heat. You can add the seasoning now.
  9. Finally, it’s time to assemble the whole dish. Place one head of chicory on each slice of ham, which you will have to fold in half. Pack all the slices in your gratin dish over the chard. Spread the cheese sauce and sprinkle the leftover cheese. You can bake this for 30 minutes until it turns golden brown in color. And there you have it, your chicory gratin is ready to surprise the taste buds of your family members or loved ones.

3. Chicory Roots Latte

You know what’s better than coffee? Chicory latte! So let’s learn how to make it right away!

Ingredients:

2 dates, pitted

2 cups water

1 tbsp of dandelion root, roasted

1 tbsp of chicory root, roasted

2 tbsp of butter

Fresh nutmeg (powder or nut)

Method:

  1. Place the dandelion and chicory roots in a pot filled with water.
  2. Boil the solution, then simmer it on low heat for about 2 minutes. Following which turn off the heat and let the mixture steep for at least 10 minutes.
  3. Now it’s time to strain the drink and transfer it into the blender with butter and dates. Blend the mix for a minute.
  4. Grate that fresh nutmeg to enjoy your delicious cup of chicory latte.

4. Dill and Salmon Chicory Boats

There’s nothing more simple, quick, and appetizing to make than these dill and salmon boats with chicory roots.

Ingredients:

8-3/4 ounces of smoked salmon or gravlax, thinly sliced

3 tbsp of fresh dill

2 tsp of honey

16 leaves of large chicory

4 tbsp of Dijon mustard

4 large radishes, trimmed and sliced

1 small cucumber, seeded and finely diced

Method:

  1. Whisk together honey and mustard. Add the dill with smoked salmon and diced cucumber. And don’t forget the seasoning at this point.
  2. Overlap the chicory leaves in order to create 8 boats. Fill each with the cucumber and smoked salmon mixture. Then garnish all of them with the remaining ingredients. Finally, it’s time to serve these boats with sliced radishes.

5. Chicory Cinnamon Spice Tea

For those who enjoy tea more than coffee! A cup of chicory roots tea with a cinnamon-spice twist provides your body with all kinds of health benefits. Plus, it’s a pretty delightful and refreshing drink to add to your daily diet.

Ingredients:

1 cup of water

1 stick of cinnamon

1 tbsp of coconut oil, organic

2 tsp of ground chicory root

Method:

  1. Place the cinnamon stick and chicory root in your tea kettle.
  2. Boil a cup of water and pour it over the cinnamon stick and chicory root. Cover this and let it steep for not more than 4-5 minutes.
  3. Then transfer this brewed tea into a blender along with coconut oil. Blend the mixture on high power for at least 30 seconds. And now all you need to do is enjoy the tea.

6. Chicory and Pesto Prawn Toast

Prawn toast gets a makeover with crispy chicory and perfect pesto along with a touch of delicious nutmeg.

Ingredients:

For prawn toast:

8 slices of multigrain bread

2 egg whites

300g of peeled prawns

Some vegetable oil

Fresh grated nutmeg

Salt and pepper, the latter freshly ground

2 tbsp of oil, the roasted hazelnut type

For pesto:

1 roughly chopped green chilli

1 clove of garlic

A big bunch of coriander

100ml of olive oil

1 tbsp of grated Parmesan

60g of walnuts

To serve:

Juice of 1 lemon

3 tbsp of olive oil

2 heads of chicory, with roots removed as well as leaves separated

Method:

  1. Let’s prepare the toast first. Pulse the peeled prawns in your food processor or blender with hazelnut oil, seasoning, nutmeg, and egg whites. The paste should become smooth before you spread it on bread slices.
  2. Heat a pan with vegetable oil. Gently fry the prawn toast until it becomes golden brown in color on both the sides. You can drain the toast on any kitchen paper.
  3. Now it’s time to prepare the pesto. Combine all the ingredients except olive oil. Place them in the blender. Pour half the amount of olive oil to make sure that the paste becomes consistently smooth. Feel free to add more oil if required.
  4. For serving the whole dish, place the chicory root leaves in a bowl. Mix lemon juice and oil in another bowl. Add seasoning to this before pouring the dressing on top of the leaves. Toss them properly to make sure that each leaf is coated completely.
  5. You can now trim the prawn toast into small pieces. All that’s left to do is place them together with the chicory leaves and pesto on a serving plate.

Wrapping It Up

Chicory root is the perfect laxative, plant-based antioxidant, and power inulin for better digestion, immune response, and metabolism. It has more gastrointestinal-enhancing benefits than other supplements. Plus, it makes a great substitute for coffee!

You will also find that chicory roots are very simple to cook and offer a unique flavor to a variety of dishes. Since chicory root is a plant-based starch, it relieves bloating, acid reflux, constipation, and cramps. Speaking about cramps, let’s not forget it also helps prevent PMS cramps, thanks to its powerful prebiotic properties.

There’s so much to look forward to with chicory roots. Use it in coffee, tea, or salads, and you can treat bacterial infections such as malaria, jaundice, and yeast. It’s possible that you’ll love its pleasant, yet strong coffee essence to such an extent that you’ll forget caffeine for good!

Cardamom aid weight loss, healthy hearts, lower blood sugar, brain function

Did you know that cardamom is a seed pod? The aromatic scent of this spice is reason enough of its powerful health benefits, but it goes beyond its gastroprotective and bad-breath eliminating properties.

The most common types of cardamom are black and green. Most recipes include only green cardamom, but that’s about to change right now. Once you know the benefits of both, you’d want more of it. Rich in phytonutrients, cardamom helps increase fat metabolism and brain function. It’s one of the most effective spices for normalizing blood pressure and blood sugar levels to prevent heart diseases, diabetes, and obesity.

Having said that, you will find cardamom at the very cusp of providing immediate relief from serious health concerns such as the common cold, inflammation, asthma, and cavity pain.

1. Cardamom Helps Fight Free Radical Damage

Cardamom is a promising spice that destroys oxidative stress caused by free radical damage. The antioxidant properties of cardamom is linked with free radical scavenging activities.

An increased consumption of cardamom can reduce your tendency of getting affected by free radical-induced diseases such as bronchitis, gastrointestinal diseases, and other conditions. It had been observed that an increase in cardamom is associated with an increase in metabolism due to the inhibition of protein oxidation and lipid peroxidation.

The results showed a significant decrease in oxidation in rats due to cardamom’s high polyphenol, flavonoid, and terpenoid capacity. (1)

Key Takeaway: Recent studies claim that cardamom offers plenty antioxidant properties to fight free radical damage in the body. Due to its high flavonoid and polyphenol content, cardamom balances GSH levels and inhibits proliferation of oxidation of both lipid and protein in the blood.

2. The Nutrients Present In Cardamom Aid Weight Loss

A proper diet and physical exercise are the two most important agents of weight loss. Thousands of studies have been conducted to prove the effectiveness of a healthy diet in humans. Having said that, cardamom is one such spice that aids weight loss and weight management.

Weight gain is a common phenomenon amongst youngsters and adults. But you can curb your cravings and increase fat metabolism with the help of cardamom extracts. The powerful nutrients in cardamom, such as melatonin, helps increase the burning process of fats in the body.

Melatonin increases stimulation of “beige fat” which is an important fat cell in weight loss. It helps burn calories in the white adipose tissues in the body. This leads to faster weight loss in unhealthy people. (2)

Another study showed that melatonin helps control weight gain in obese patients. This is due to its anti-diabetic and blood pressure-enhancing properties. The study was conducted on young obese rats with the results proving that melatonin reduces cholesterol levels, blood pressure, and improves lipid profiles. All of these factors play an important role in weight loss in most humans. (3)

Key Takeaway: These aromatic pods acts as natural weight loss supplements for obese patients. It also reduces symptoms of heart disease such as high blood pressure, abnormal lipid profiles, and high cholesterol levels in patients most likely to gain weight or become obese.

3. Cardamom Reduces Stress-Induced Cognitive Impairment

Cardamom helps reduce brain damage linked with stress. Multiple studies have shown that cardamom extracts can be used as a stress-reducing agent to reverse or prevent cognitive impairment in adults.

Cardamom contains high amounts of thiamine and vitamin C which play a major role in enhancing neurodevelopment and brain function. A study focusing on the relationship between thiamine consumption and brain damage showed that thiamine reduces oxidative stress and curbs neurotransmitter-related abnormalities. (4)

Oxidative stress injury can directly have a major influence on the hippocampus or cortex region of the brain. This can suppress learning abilities, memory, communication skills, and so forth.

In one study, thiamine normalized brain levels in stress-induced mice, hence decreasing oxidative damage in the brain cells and increasing energy metabolism for faster cognitive function. (5)

Vitamin C, a powerful antioxidant present in cardamom, reduces the serious effects of stress on the body. It eliminates the way the body responds to stress which could enhance the “flight or fight” response and strengthen our immune system. (6)

Key Takeaway: Multiple studies prove that cardamom contains powerful anti-stress compounds such as thiamine and vitamin C. It is key to maintaining brain health by reducing oxidative stress injuries in brain cells.

4. Cardamom Plays A Major Role In Cancer Prevention

Cardamom, being an aromatic spice, plays a role in destroying cancer cells and suppressing tumor growth. Black cardamom is known for its free radical scavenging abilities. Hence, it also plays a hand in inhibiting chemical carcinogenesis in the body.

Cardamom oil can prove to be a serious agent against the proliferation of cancer cells due to its high phenolic capacity. Due to the presence of highly-reactive substances, cardamom increases the detoxification process in the body. It also contributes to reducing colon cancer by decreasing azoxymethane levels in the colon. (7)

Cardamom is a major source of essential oils, known for their immune-enhancing properties. These essential oils also work as anti-cancer agents to reduce apoptosis in the body. They restrict cell cycle arrest and regulate DNA repair to fight unhealthy cells faster than traditional methods. (8)

The powerful enzymes present in such essential oils help ward off infections and inflammatory reactions associated with cancer. It also plays a hand at reducing inflammation caused by lots of lifestyle and genetic-related factors such as smoking, tobacco use, alcohol, etc.

Key Takeaway: Cardamom not only helps destroy cancer cells in the body, but it also helps neutralize symptoms that could cause cancer in the future. Lots of factors such as smoking, pollution, exposure to chemicals, alcohol, high-salty diets, etc. can cause different types of cancer.

5. The Essential Oils In Cardamom Have Powerful Therapeutic Properties

Cardamom consists of essential oils that, once extracted, can aid serious health concerns in a positive manner. The science behind their therapeutic properties show that it positively affects a person’s sleeping habit.

Inhalation of essential oils can have a drastic influence on sleep. So if you’re having difficulty sleeping at night, or you’re restless even while sleeping, you can have cardamom essential oil by your side to help alleviate that discomfort.

One study on multiple controlled trial proved that essential oils have a powerful hypnotic effect on the brain and body. It can help people with minor sleep disturbances such as insomnia, restlessness, and sleep walking. (9)

The necessity of sleep is inevitable in every human. And the lack of it can cause serious mental and physical problems.

Key Takeaway: Apart from aiding cognitive impairment, cardamom may help prevent sleeping problems in most individuals. It can be used as an essential oil for inhalation before getting ready for bed.

6. Cardamom Contains Calcium Which Supports Healthy Bones

It’s no surprise that foods rich in calcium significantly lower bone damage and weakness. Cardamom is an anti-inflammatory spice, and like its relatives, it contains good amounts of calcium.

Calcium limits bone pain and swelling caused due to environmental and genetic factors. If you’ve heard of osteoporosis, you know what loss of bone can do to one’s body. But with a calcium deficiency matters could get even worse.

Apart from benefiting certain metabolic processes in the body, calcium is absorbed by the bones for proper mobility and strength. Without proper calcium absorption, it could cause abnormal bone development, fractures, and joint inflammation. (10)

A study conducted on human participants proved that a daily consumption of 1000 mg of calcium in children, men, and women can improve overall bone health.

One study studying the effects of calcium also proved that taking calcium-rich supplements, including spices, can increase bone mineral density. (11)

Key Takeaway: Increasing your calcium intake with the help of cardamom can lead to reduction of bone damage. It helps increase bone mineral density which is the leading agents of reduced bone fractures and osteoporosis in older adults.

7. People Consuming Cardamom Live A Longer Life

Cardamom is home to many nutritive compounds that help older adults live a healthier life. They include calcium, potassium, magnesium, and fiber. (12)

These nutrients help alleviate age-related problems while regulating a healthy immune system. As we get older, the digestion and absorption of certain nutrients decreases drastically causing more health problems than ever. That’s why you need these essential nutrients in your daily diet.

That said, another study proves that vitamin C also plays a hand in healthy aging. Vitamin C deficiency is a contributor to age-related degenerative problems. (13)

It is well-documented that nutrients such as calcium, fiber, vitamins, and minerals play a role in reducing intolerance and chronic disease risk associated with aging.

Calcium, on the other hand, helps increase lactose tolerance in the body. This ensures stronger bones and a healthy immune response. Calcium helps in the maintenance of hormones and other nutrients in the bloodstream. It balances glucose levels in older diabetic patients and alleviates abnormal kidney, intestine, and liver response. (14)

Key Takeaway: Cardamom is good for balancing lactase deficiency, digestion, and glucose levels in older adults. It consists of powerful nutrients that aid aging and help you live longer.

8. Manganese Present In Cardamom Prevents Parkinson’s Disease

Parkinson’s disease is a chronic brain disorder that’s irreversible and just gets worse with time. There’s no definite cure for this movement disorder just yet, but you can consume certain foods to lower your chances.

It can also be said that certain types of food, such as cardamom, can help alleviate severe symptoms of this disorder. Such as tremor of the hands, legs, and face, instability, stiffness, and slow mobility. (15)

Cardamom contains one powerful nutrient that is proven to have Parkinson’s disease reducing properties. A proper balance of manganese in the body can helps enhance neurotransmitter pathways between the brain cells and other brain regions. (16)

Based on magnetic resonance imaging (MRI) reports, an increased consumption of manganese in the body can improve hypothalamus and cortex function. It helps in the transportation of protein to different parts of the brain.

Also, it helps enhance neuron function and reduces the amount of unhealthy and degraded neurons in the blood cells. This stimulates neuropathological changes in the favor of healthy brain function.

Key Takeaway: Cardamom is the biggest source of manganese which is 80% of the recommended serving. It helps eliminate brain cell damage that might cause Parkinson’s disease which is a chronic movement disorder.

9. Cardamom Is A Powerful Spice For Promoting Dental Health

Oral health is as important as digestion, cognition, and the immune system. Any excessive bacteria formation in the mouth can lead to severe infections and even mouth cancer.

Cardamom is a serious contributor to oral health as it helps prevent bad breath, cavities, and mouth ulcers. It kills harmful bacteria formation that leads to bad breath. Also it prevents tooth decay associated with the intake of salty and fried foods.

Having said that, a study conducted on the effectiveness of cardamom proved that cardamom seeds have antimicrobial effects that kill oral pathogenic bacteria in the mouth. (17,18)

It is an effective remedy against tooth decay and formation of germ particles on the surface of the tongue. Maybe that’s why you hear the phrase “cardamom comfort” so much on health-related channels. It helps reduce dental problems to a higher degree than other natural remedies.

Key Takeaway: Interestingly, the antimicrobial properties of cardamom extract and cardamom seeds helps reduce bacteria formation in the mouth. Due to its phenolic compounds, it fights tooth decay, bad breath, mouth ulcers, and other infections.

10. The Powerful Compounds Of Cardamom Help Reduce Hypertension

Hypertension (high blood pressure) is a major contributor to heart diseases, diabetes, and other digestive problems.

It’s commonly known that powerful aromatic spices and herbs help alleviate high blood pressure. So if you have your blood pressure checked regularly, you might notice a difference in overall health with the help of cardamom.

You can infuse cardamom in coffees and teas or add them to your daily meals for its blood pressure-lowering properties. (19)

Cardamom also lowers your chances of developing atherosclerosis and heart attacks associated with hypertension. (20)

Using cardamom in powdered form or in soups and other meals is a good way to lowering blood pressure for a healthy heart.

Key Takeaway: Not only can cardamom ease digestion, but it can lower blood pressure associated with hypertension. It also helps prevent other severe conditions linked with high blood pressure such as heart attack, stroke, and atherosclerosis.

11. Cardamom Contains Good Fiber Along With Phytonutrients To Prevent Heart Diseases

Maintaining cardiac health is essential to the immune system and metabolism. Cardamom consists of many nutrients that alleviate heart diseases. These nutrients include fiber, zinc, and other phytonutrients.

Zinc is known for its cardiac-stimulating properties. Zinc deficiency in the body is associated with weak heart muscles and abnormal cardiac function, studies suggest. It also causes more oxidative stress in the bloodstream. (21)

To decrease cellular stress, increase proper blood flow to and from the organs, and increase heart tissue mass, an increased consumption of zinc is essential.

On the other hand, dietary fiber is proven to reduce risk of cardiovascular disease caused by lifestyle-related factors in humans. It improves fat metabolism, glucose metabolism, and body weight regulation. (22)

Phytonutrients, present in cardamom, also play a significant role in reducing inflammation associated with multiple diseases including heart disease, cancer, and dementia. (23)

Key Takeaway: Cardamom contains fiber, zinc, and phytonutrients that help reduce risk of developing cardiovascular diseases. There is plenty of evidence that proves that it has cardiac-stimulating effects within the body.

12. Cardamom Can Help Cure Metabolic Disease

Cardamom is key to lowering your chances of developing metabolic diseases. Black and green cardamom helps decrease plasma triglycerides and body fat. Both of these factors are crucial for enhancing fat metabolism in the body.

Moving forward, other factors linked with metabolic diseases such as hypertension, obesity, diabetes, etc. can also be controlled with the help of cardamom.

One study conducted on rats proved that an increase in cardamom consumption can positively affect cardiac collagen deposition, plasma processes, and vascular reactivity in the body. This reduced their chances of metabolic syndrome by almost 90%. (24)

Another study tested the effectiveness of cardamom extracts on the metabolic enzyme required for proper stimulation of the immune system. This plays a hand in lowering metabolic inflammation in the body. (25)

Key Takeaway: Cardamom helps decrease systolic and diastolic pressure levels in the body. It also encourages better glucose and immune response to fight inflammatory metabolic enzymes within the body.

13. The Vitamins And Riboflavin In Cardamom Can Promote Eye Health

Traditionally, cardamom is used in therapies that promote eye health and vision. It’s an important spice that has been used to cure blurred vision by improving proper blood circulation to the eyes.

Thanks to its riboflavin content, cardamom symptoms of vision loss in older adults. The bioflavonoids and vitamin C present in cardamom reduce oxidative stress linked with age-related macular degeneration.

It also helps form the connective tissue in the eyes, which plays a major role in keeping the cornea of the eye healthy and stable. This vitamin C also supports long-term vision by preventing cataract formation in humans. (26)

Another report suggests that consumption of vitamin C in the blood lower risk of cataract formation by 33%. Other tests proved that this antioxidant suppresses free radical-induced oxidative stress associated with early lens opacities, which is a chronic eye condition. (27)

Key Takeaway: The vitamins and riboflavin present in cardamom decrease risk of age-related macular degeneration, cataract, loss of transparency, and vision loss in adults.

14. Regular Consumption Of Cardamom Prevents Digestive Problems

You must have read somewhere that cardamom is traditionally used as Ayurvedic medicine for immediate gastrointestinal relief from constipation, acid reflux, etc.

The carotenoids present in cardamom also offer antioxidant and starch hydrolase inhibitory properties. This enhances normal digestive processes by reducing chronic gastric conditions.

Overall consumption of cardamom extracts improves intestinal and pancreatic health. It soothes the inner linings of the stomach to fight against acid reflux, stomach ulcers, and cramps. (28,29)

Multiple studies prove that people who struggle with daily digestive problems, the methanolic extracts found in cardamom help ease such discomfort. It also reduces inflammation caused in the stomach due to lifestyle-related factors such as alcohol, smoking, and aspirin.

Key Takeaway: Cardamom provides immediate relief from stomach problems such as ulcers, infections, and inflammation. It is a major component to enhance digestion and control other severe symptoms of gastrointestinal disorders such as liver disease, chronic constipation, and acid reflux.

Recipes

Did you know that cardamom seeds belong to a plant that is a part of the ginger group? But everybody knows that cardamom gives out a strong and wonderful aroma. And the taste is enticingly warm with a sweet, spicy flavor. You can cook with the entire pods or extract the seeds from within and add them to the dishes.

Once you add even a little bit of cardamom to your food, it has the ability to make a world of a difference. So let’s move on to talking about the deliciousness of cardamom. There are many different types of dishes that you can prepare with a dash of this aromatic spice in them.

1. Chickpea Lemon Muffins

Let’s start with this delightful sweet snack that boasts cardamom flavor with a classic lemon twist. And we all love muffins anyway, don’t we?

Ingredients:

1/2 tsp of salt

2/3 cup of flour, whole wheat and sifted

2 tbsp of lemon juice, freshly squeezed

2 tbsp of orange juice, freshly squeezed

2 eggs

Zest of 2 lemons

Zest of 2 oranges

1 chickpea can (the chickpeas should be drained as well as rinsed)

1/2 cup of granulated sugar

1/2 tsp of ground cardamom

2 tsp of baking powder

1/4 cup of olive oil, extra virgin

1/3 cup of almond meal

For the topping:

1/4 tbsp of ground cardamom

1-1/2 tbsp of granulated sugar

Method:

  1. Preheat your microwave to 325 degrees Fahrenheit. Use paper liners to line the muffin tin. Then puree the orange and lemon juice and zest with egg yolks, sugar, olive oil, and chickpeas. You can do this in a food processor or blender until the mixture turns smooth.
  2. The next step is to sift together baking powder, cardamom, almond meal, salt, and flour in a large-sized bowl. Then add the chickpea paste into this bowl.
  3. Now it’s time to whisk the egg whites and fold them into the batter.
  4. In a small bowl, bring together cardamom and sugar and keep it aside.
  5. You can scoop the batter into the muffin tin. Each muffin should contain at least 1/4 cup of the batter. Top it off with cardamom-sugar mixture.
  6. Finally, bake the muffins for 30 minutes. Insert a toothpick into the center to check if the muffins are ready to provide your taste buds with a burst of delicious flavor.

2. Pickled Plum, Radish, and Jicama Salad

This recipe is an unusual mix of crushed cardamom pods with a delicately seasoned salad.

Ingredients:

For the plum sauce:

1 tsp of sugar

3 plums, chopped into eight wedges

1 ginger, peeled

1 tsp of kosher salt

1/4 cup of orange juice, freshly squeezed

2 pods of cardamom, crushed lightly

1 tsp of juniper berries

2 tbsp of apple cider vinegar

Red pepper flakes, crushed

1/2 tsp of gochugaru

2 tbsp of lime juice, freshly squeezed

For the salad:

1/4 cup of rice vinegar, unseasoned

1 plum, chopped into wedges

1 peeled jicama, sliced into matchsticks

1/4 tsp of kosher salt

1/2 cucumber, sliced and divided

2 watermelon radishes, sliced into matchsticks

1/4 cup of thinly sliced mint leaves, divided

1/3 cup of roasted unsalted peanuts, chopped and divided

1 tsp of sumac

1 tsp of Aleppo pepper

Some sea salt

Method:

  1. First, you need to prepare the plum sauce. For that, add salt, sugar, and plums into a saucepan. Once plums release their juices, which takes about 2 hours, bring in the gochugaru, juniper berries, vinegar, orange juice, cardamom, and ginger.
  2. Let this boil until the plums become jammy and break down. This should take not more than 20 minutes. Then add the lime juice and let it cool.
  3. Strain this plum sauce using a sieve into a bowl. Make sure to discard the solids. Then keep it aside. You can chill the sauce if you like.
  4. The next step is to prepare the salad. Toss vinegar, 1/4 teaspoon of kosher salt, and plum in a bowl. The goal is to pickle the plum lightly, which takes about 15 minutes. Then drain.
  5. Bring together 1 teaspoon of Aleppo pepper, 1 teaspoon of sumac, half mint leaves, half peanuts, half cucumber, radishes, jicama, and pickled plum. Now you can add 2 tablespoon of plum sauce with kosher salt seasoning in the bowl.
  6. Top the salad with the remaining ingredients before drizzling the whole dish with more plum sauce. And there you go, your salad is ready!

3. Butter Chicken

Cardamom blends with cream, butter, and tomatoes to give you a taste of the spicy, aromatic Indian cuisine.

Ingredients:

For the marinade:

4 cloves of garlic, grated

1/2 cup of Greek yogurt

1 tbsp of ginger, finely grated

1 tbsp of fenugreek leaves

2 pounds of skinless, boneless chicken thighs

2 tsp of kosher salt

For the rest of the dish:

1 medium cinnamon stick

1/2 cup of unsalted butter

1 clove, whole

5 cardamom pods, green

2 sliced onions

2 tsp of fenugreek seeds

Kosher salt

2 sliced serrano chiles

1 tbsp of ginger, finely grated

4 cloves of garlic, grated

1 tsp of paprika

1 tbsp of garam masala

2 cans of peeled tomatoes

1/2 tsp of ground turmeric

1/2 cup of heavy cream

1 tbsp of fenugreek leaves

Method:

  1. The preparation of the marinade comes first. For that, you need to whisk salt, ginger, fenugreek leaves, garlic, and yogurt. Then add the chicken to the mix and toss it to coat. You can chill the marinade for at least 2-3 hours.
  2. In the meantime, melt 4 tbsp of butter in a pot over medium flame. Cook the fenugreek seeds, clove, cardamom pods, and cinnamon. Wait for them to become fragrant and slightly dark. Then bring in the chiles, onion, and salt. Let this cook until the onion turns golden. This should take not more than 10 minutes.
  3. Now is the time to add ginger and garlic and wait for them to turn fragrant. Then add turmeric, paprika, garam masala, and fenugreek leaves. Let them cook for a minute before tossing in the tomatoes. Break them up into pieces using a spoon. Once the liquid evaporates, mash the tomatoes with a large spoon or potato masher. Simmer uncovered until the sauce becomes consistently thick. This means let it simmer for at least 50 minutes. Then discard the cinnamon stick from the cooking pot.
  4. At the end of which you need to transfer the whole mixture into your blender. Puree it until the paste becomes smooth. Then add the remaining butter along with cream and blend it until you achieve a creamy paste. Don’t forget to season it with salt before returning the dish to the cooking pot. Let it simmer.
  5. In the meantime, preheat your broiler. Arrange all the chicken on the wire rack placed inside a baking sheet lined with foil. Broil the chicken pieces until they turn brown on both the sides. Following which you can chop the chicken pieces and add them to the simmering sauce.
  6. Let the whole thing cook for at least 10 minutes. Add some cilantro topping and serve the delicious buttery, creamy chicken with either rice or naan.

4. Cardamom Masala Chai

Learn how to make the perfect masala chai with cardamom and ginger. You can add maple syrup as well if you like your tea to be on a slightly sweeter side.

Ingredients:

1 medium cinnamon stick, crushed lightly

1 piece of fresh ginger, coarsely grated

14 cardamom pods, crushed lightly

1/4 cup of maple syrup, pure

2-3/4 cups of milk

6 tsp of loose black tea

Method:

  1. Boil 3-1/2 cups of water with cinnamon and ginger in a saucepan on medium heat. Then reduce the heat and simmer and stir occasionally. By this time, the quantity of liquid will have reduced a little bit. All this should not take more than 20 minutes.
  2. Turn off the heat before adding cardamom and tea.
  3. Then return the pan to medium heat. Pour maple syrup and milk into it. Cook until the mixture starts to boil and foam up. Once that happens, turn off the heat.
  4. Let the cooked tea sit for at least 5 minutes. Then strain it with the help of a sieve and serve it nice and warm.

Wrapping It Up

Cardamom has a long history of medicinal and herbal use in Chinese medicine. Modern scientific research has confirmed its effective benefits on human health for many health markers such as hypertension, cognitive disorders, oral cavities, digestive problems, etc.

Now that you know cardamom’s powerful effects on all biological systems in the body, it’s time to incorporate cardamom-infused desserts, teas, and salads in your diet. It’s a heart and mind-healthy spice that could boost intelligence and make you feel less stressed and tired.

To make things easier for you, I have also compiled a small list of cardamom-rich recipes that I know you’ll love. This will help you incorporate more cardamom-rich meals on a daily basis. These recipes are easy to make and require minimal cleanup.

Health Benefits of Berberine

A herb capable of boosting your immune system, improving heart health, and reducing the risk of cancer, is here to stay! It consists of berberine, which is a powerful alkaloid to treat multiple digestive and anti-aging problems. Multiple studies on the effectiveness of have shown that extract has powerful and nutritious properties.

People have consumed for its impressive health benefits. Some of which you already know while some still remain an enigma. Universally, extracts have been used for medicinal purposes and as natural healers for treating high blood pressure (hypertension), diabetes, high cholesterol, oxidative stress, and free radical-induced diseases.

1. Berberine Present In Fights Antibiotic Resistance

Antibiotic resistance is a common condition. It arises due to the intake of excessive antibiotics in the body. The role of antibiotics is to kill harmful bacteria in the body. But this leads to bacterial resistance which means the residual germs and bacteria left in the body act against the antibiotics while rapidly growing out of control.

This leads to numerous other problems that antibiotics are unable to treat or prevent. In fact, the more antibiotic you consume at this point, the worse it gets. This influences the DNA synthesis process while weakening your immune cells to fight and replace the harmful bacteria in the body. (1)

Antibiotic resistance can be controlled with the help of berberine compound. Berberine is found in the roots, stems, and the bark of . It is powerful enough to target antibiotic resistance to have long-term health benefits. It reduces your chances of catching the flu or viral cold due to a bacterial infection.

Plus, antibiotic resistance is also associated with other diseases such as heart disease, cancer, gastrointestinal problems, and allergies. The consumption of berberine, present in , is important for its anti-tumor, anti-inflammatory, and antimicrobial properties. (2)

Key Takeaway: Increased consumption of for its berberine content is essential for preventing severe antibiotic resistance. Older adults who consume lots of antibiotics can reduce signs of inflammation and bacterial infection with .

2. Treats Various Types Of Infection

is incredibly healthy, that you already know of, but what about its specifics? They’re especially rich in berberine sulfate, which is a strong alkaloid that helps prevent antibiotic resistance.

But this alkaloid has other antimicrobial properties too. It helps to prevent the development of different types of infections including urinary tract, bladder, sinusitis, respiratory, and gastrointestinal infections.

A study conducted on berberine sulfate showed that an increased intake of this compound can reduce effects of lipoteichoic acid-fibronectin complexes. This kills of host cells that are associated with various types of infections mentioned above. So higher doses of extract can keep infections at bay and improve overall immune responses towards such harmful bacteria. (3)

Key Takeaway: A recent study has suggested that plays an important role in the suppressing of certain host cells that could give rise to infections such as sinus, inflammatory diseases, sore throat, urinary tract infection, and so on.

3. Is A Powerful Anti-Cancer Herb

Most herbs are rich in antioxidants such as vitamin C which plays an important role in preventing cancer growth. is one of those herbs. contains good amounts of vitamin C that are effective in targeting and suppressing cancer stem cells in the body.

A study conducted on the metabolism of cancer stem cells proved that vitamin C is 10 times more effective than other methods. It helps suppress the growth of fatal tumors in the body. This is often fuelled by the rapid proliferation of damaged cells in the bloodstream. (4)

Vitamin C, once digested, breaks down into hydrogen peroxide. Cancer cells with very low or abnormal levels of catalase enzymes are unable to get rid of hydrogen peroxide. This leads to an increase in fatal tumor growth and cancer cells proliferation in the body. (5)

Lastly, vitamin C sensitizes harmful cancer cells that escalate due to radiation or chemotherapy. This means vitamin C not only plays a role in the killing of cancer cells, but it also helps reduce effects of chemotherapy and radiation for treating cancer.

A high dose of vitamin C during chemotherapy can help cancer patients cope with the possible side-effects that hinder the proper blood circulation of the body. Also, participants of this study also claimed that it had a positive effect on blood pressure and general immune response towards chemotherapy and radiation. (6)

Key Takeaway: Multiple studies verify that vitamin C, present in huge amounts in , contributes to the inhibition of cancer cells and tumors in the body. A high dose of vitamin C during chemotherapy and radiation can have a positive effect on blood pressure and the immune system.

4. Helps Improve Liver And Gallbladder Health

Due to the exposure of numerous chemical compounds and toxins, the body needs a powerful detoxification agent to get rid of harmful bacteria and oxidants. This can be done through the proper regulation of the liver and gallbladder.

contains berberine alkaloid which plays an important role in cleansing the liver and gallbladder of bile. Bile, as you already know, keeps your digestion process healthy and consistent by digesting fatty foods. So an increased secretion of bile from the body can help alleviate liver and gallbladder problems while keeping other gastrointestinal problems at bay.

This study focused on the positive effects of on the liver, gallbladder, and the digestive system. It showed that, due to lifestyle-related factors, bile secretion can be hindered. This leads to high cholesterol, inflammation, thyroid diseases, and diabetes.

acts as a powerfully mild laxative to flush away all toxins from the liver and gallbladder while regulating the digestive system with proper bile secretion. (7)

Key Takeaway: Barberries are good sources of laxatives and antioxidants that help cleanse the liver and gallbladder to increase bile secretion in the body. Low levels of bile secretion, due to an unhealthy diet, can cause weight gain, heart problems, and diabetes.

5. The Nutrients Present In Lower Heart Disease Risk

is a powerful herb containing antioxidant and blood pressure-reducing properties. Both of which play a great role in lowering the risk of cardiovascular diseases.

The active compounds present in , including berberine, helps lower cholesterol levels and blood pressure. Hypertension, or high blood pressure, is a commonly growing phenomenon in the world today. Lots of people are suffering from severe heart problems due to stress, environment, and genes related factors.

Berberine reduces blood sugar levels, elevated blood pressure, high LDL cholesterol, and excessive fat buildup in the body. It’s no surprise that most diabetic patients have a heart problem. But you can help alleviate that with the help of an increased diet. (8)

People with metabolic syndrome also experience elevated blood pressure and cholesterol levels. So a study proved that a higher concentration of can reduce the oxidative stress associated with this disease. (9)

Lastly, the anti-atherogenic properties of extract can help reduce the risk of heart disease in patients with a chronic diabetes problem. (10)

Key Takeaway: intervenes the proliferation of cardiovascular disease from all phases. It lowers blood pressure, treats LDL cholesterol levels, suppresses oxidative burden, and treats heart problems in diabetic and metabolic syndrome patients.

6. Helps Reduce Skin Inflammation And Treats Skin Disorders

Inflammation is one of the leading causes of skin disorders and skin infections in most humans. Thanks to its antibacterial properties, there are certain types of skin disorders that can help alleviate.

According to a report, reduces inflammation caused by genetic, environmental, and lifestyle factors. It prevents acne, signs of aging, and decreases certain skin conditions such as psoriasis. The medicinal use of is extremely effective and so is its therapeutic properties.

Recent studies have managed to prove that people who eat have an added advantage for dealing with lots of acne, yeast infections, and other skin conditions. (11)

It also helps decrease inflammation of certain types of skin ulcers and candida infections commonly found in the vagina for most women.

Key Takeaway: contains powerful antioxidants with anti-inflammatory properties. They help in preventing and treating many skin conditions such as acne, yeast infections, and other signs of skin inflammation.

7. Works As A Powerful Herb For Healthy Weight Loss

Another impressive health benefit of berberine, present in , is its ability to lower lipid levels to aid weight loss in obese patients.

There aren’t many medicinal or therapeutic methods for treating obesity, especially those with metabolic problems. acts as a natural obesity-treating agent, thanks to its high berberine capacity. It helps in the regulation of certain active enzymes such as adenosine and protein kinase which are metabolic boosters.

These enzymes help burn fat faster while activating mitochondrial activity for better weight loss.

The study focused on increasing berberine dosage in obese human participants. Factors such as hormone levels, blood lipid levels, metabolic panel, and body weight were taken into consideration. The results showed that berberine supplementation leads to mild weight loss while drastically lower blood lipid levels in obese patients. (12)

The participants were fed 500 mg of berberine 3 times a day for 3 months. This was conducted on the oral supplementation of berberine.

Key Takeaway: In obese patients, blood lipid levels, weight, and hormone levels are always elevated. To treat the severe effects of obesity, you need something strong and effective, such as berberine, for lowering blood lipid levels.

8. Reduces Lung Inflammation Caused By Smoking

If you’re a chronic smoker, you need a higher dose of antioxidants, including berberine, to fight lung inflammation. Cigarette smoking-induced inflammation can lead to irreversible health problems such as cancer.

It can also cause permanent lung injury which could block airways for proper inhalation and exhalation. This could lead to severe age-related respiratory problems without solutions to look for.

That said, berberine is shown to have positive anti-inflammatory properties. It regulates fluid retention and cellular edema which is a contributive agent to lung inflammation. (13)

This study focused on cigarette smoke-induced mice. They were treated with a higher dose (50 mg) of berberine extract to test results of reduced inflammation in the lungs. The results proved positive in the favor of its powerful anti-inflammatory properties.

Key Takeaway: One study found that extract can be a beneficial addition to the diet of people who smoke. It reduces inflammation in the lungs, thus inhibiting any risk of developing cancer or other respiratory diseases.

9. Aids The Treatment Of Small Intestine Bacterial Overgrowth

Small Intestine Bacterial Overgrowth, or SIBO, is characterized by excessive bacterial growth in the small intestine. The only medicinal treatment of this disease is an increase in antibiotics, which too is a contributive agent to antibiotic resistance in the body.

Another therapeutic and effective method for reducing SIBO is . extract works as a healthier alternative to antibiotics. It has powerful antimicrobial properties which aid normal gastrointestinal health in unhealthy people. So it can definitely reduce the proliferation rate of SIBO as a natural, herbal remedy. (14)

Lots of factors contribute to the development of SIBO in the human body. But the most common of them all is alcohol consumption. This could lead to constipation, bloating, abdominal pain, and acidity.

The reports suggest that even a single drink per day can increase your chances of developing SIBO. (15)

Key Takeaway: Berberine has also been shown to have positive SIBO-preventing properties for people who drink alcohol on a daily basis. The studies indicate that supplementation of is associated with a decrease in bacterial growth and regulation in the body.

10. Contains Berberine Which Might Prevent Alzheimer’s Disease

According to multiple studies, berberine has neuroprotective properties against the development of Alzheimer’s disease. It reduces neuroinflammation in the skin cells which is directly associated with oxidative stress and free radical damage.

Alzheimer’s disease, being an irreversible neurodegenerative disorder, affects older adults. It leads to hindered communication skills, memory loss, restlessness, and other severe symptoms. However, with the help of berberine, memory loss and lack of communication skills can be reduced. (16)

One study has shown that berberine triggers the inhibition of amyloid peptide which plays a contributive agent in the development of AD. The results showed that berberine reduces cellular toxicity in the brain while acting as a natural therapeutic agent for the treatment and prevention of AD. (17)

Key Takeaway: Berberine accelerates neuronal growth in the presence of Alzheimer’s disease. It also helps inhibit the production of amyloid peptide in the brain cells.

11. Used In Zyflamend Supplements Promote Healthy Joints

Zyflamend is a herbal supplement that contains high amounts of along with basil, turmeric, green tea, and oregano. It has anti-cancer, anti-diabetic, anti-inflammatory, and immune-enhancing properties. (18)

Along with all its impressive health benefits, zyflamend is known for its ability to treat and prevent joint inflammation and disorders. It reduces joint pain, inflammation, stiffness, and overall movements.

Osteoarthritis, which is a common degenerative disease, is characterized by stiff and aching joint. It is due to lack of cartilage support and maladaptive growth that causes excessive inflammation in the joints. Based on multiple clinical studies, it can be said that zyflamend, due to its high antioxidant capacity, can reduce effects of joint disease and inflammation in the body. (19,20)

People who consumed this showed higher levels of movement including more walking time, reduced pain, and increased flexibility.

Key Takeaway: is present in good amounts in zyflamend which is a herbal supplement used for treating unhealthy joints. It reduces the risk of several bone-related diseases including osteoporosis which is also an age-related chronic illness.

Some Delicious Recipes

These tiny red jewels can be quite easily stored in the kitchen cabinet. You can sprinkle them over rice or pot roast chicken to add a dash of color and tart flavor. Since barberries are mostly dried, they have the ability to keep well. All you need to do is lightly soak, fry, or simmer them. That is enough to activate their gorgeous color and delicious flavor.

So now it’s time to get our hands on the five most delectable recipes!

1. Saffron and Hummus with Black Chickpea

When you combine two popular ingredients like chickpea and tahini (also known as ardeh) with , the result is undeniably divine.

Ingredients:

1/3 cup – olive oil (extra virgin)

3 cups – black chickpeas

1/4 tsp – chilli powder

1 tbsp – thick tahini

1/2 tsp – salt

1 lime zest or 2 limes juice

1 cup of chickpea water

For the sweet, sour sauce of saffron and :

4 tbsp – water

2 tbsp – dry

2 tbsp – brown sugar

A pinch of saffron

For the toppings:

Some dry mallow

Parsley, finely chopped

Walnuts, finely chopped

Method:

  1. The first step is to soak the black chickpeas for at least 8 hours before you start the procedure. Following which drain them properly. Then cook the chickpeas in water and wait for them to become soft. Then keep them aside and let them cool.
  2. In the meantime, you can prepare sauce. Take a small-sized saucepan and add saffron, sugar, water, and barberries into it. Let it all boil on medium heat. Once the sugar melts, it’s time to blend all the barberries with the help of your hand blender. Then set it aside.
  3. Now you can use a blender or food processor to create a mixture of black chickpeas along with the cooking water, salt, chilli powder, lime juice or zest, and tahini. This is to prepare the hummus, so keep blending until you achieve the desired smoothness and thickness.
  4. After that, add olive oil to the hummus and blend again.
  5. At this point, you can choose to mix sauce into the hummus or serve it separately on top of it. Finish it off by adding the chopped parsley, walnuts, and dry mallow.

2. Lebanese Fig and Freekeh Salad

The salad is not only highly nutritious but it also offers a unique flavor to satisfy your taste buds.

Ingredients:

1 tbsp of sesame seeds, toasted

2 tbsp of dried barberries

2 black figs, sliced

4 tbsp of feta or goat cheese

1 tbsp of olive oil

1 tsp of dried mint

1 tbsp of parsley, chopped

1 tbsp of mint, chopped

1 coarsely chopped red onion

1/2 tsp of spice mix (Lebanese)

3/4 cup of sifted freekeh

Sorrel or rocket (optional)

Lemon squeeze (optional)

Method:

  1. Heat oil on medium flame before adding salt and onion. Cook this on a saucepan until the onion starts to smell sweet.
  2. Then bring in the spice mix and stir the whole thing. Now it’s time to add water and freekeh. Bring this to a boil before simmering it for at least 10 minutes. During this time, the water will get absorbed, which will make the freekeh tender. Once this happens, you know it’s time to turn the heat off.
  3. On the side, use medium flame to heat a pan for fig slices. Cook them for not more than two minutes on both the sides. Then set them aside.
  4. Then you can add dried barberries, parsley and mint to the freekeh and stir the blend. It’s better to fluff it with the fork. Bring in some cheese and seasoning too.
  5. You can divide this salad into two bowls before topping each one with sesame seeds, fig slices, and remaining cheese. Drizzle the olive oil on top and serve with sour leaves or lemon squeeze.

3. Chicken Rice (Zereshk Polow)

Learn to prepare the perfect Middle Eastern-style rice.

Ingredients:

1 tsp of sugar

4 tbsp of butter

3 tbsp of plain yoghurt

4 tbsp of milk

3 handfuls of rice, preferably basmati rice

500g of chicken breasts or thighs, cut into large pieces

1 tsp of turmeric

50g of dried barberries

3 red onions, finely sliced

A pinch of good saffron

Some rock salt

Method:

  1. Wash the rice thoroughly before boiling it. Cook it on low flame until all the water gets absorbed to soften the rice. Then you can place the rice in a medium-sized bowl.
  2. Before cooking the barberries, soak them in water for not more than 10 minutes. Then add them with butter and sugar in a cooking pan. Stir the barberries well to encourage the puffing up process. It’s important to keep moving them on the pan as they tend to burn easily.
  3. Then take a small-sized bowl to bring together saffron and milk. Stir the solution and let it rest. Once it turns yellow, add yoghurt and blend it thoroughly.
  4. Now it’s time to cook the onions with butter. Let the onions fry on a large-sized pan until they become bronze in color. Following which place them in another bowl.
  5. To prepare the chicken, add some turmeric to it and keep it aside in a different bowl. Then use the same onion pan to gently cook the chicken. Once it turns brown on both the sides, add water and let it simmer without the lid for at least 15-20 minutes. At the end of which transfer the chicken and its liquid with the remaining bits in two separate bowls.
  6. Finally, it’s time to do the layering. In the same cooking pan, first add some butter to cover the sides and bottom. The rice goes first soon followed by the chicken on top. Then another rice layer with barberries. Next come the onions with the saffron yoghurt milk. And the last layer is the juicy chicken liquid that you placed in a separate bowl after cooking the chicken. Then sprinkle some rock salt on top.
  7. Place this in your preheated oven. Set it at 300 degrees Fahrenheit for half an hour. Keep the lid of the pot on so that all the flavors blend together.
  8. And that’s about it. Once it’s done, serve the delicious main course nice and hot!

4. Dill Rice

Another delicious rice recipe, but this one’s easy to prepare. You can pair it with your Thanksgiving leftovers or even as a tasty side dish.

Ingredients:

3 tbsp of lemon juice, fresh

2 cups of basmati rice (don’t forget to rinse as well as drain it)

1 medium minced shallot

Sea salt and pepper

4 tbsp of softened butter, unsalted

1/2 cup of dried barberries

3/4 cup of chopped dill

Method:

  1. The first step is to boil the rice before you add salt. Stir it once and then cook it on low flame until all the water gets absorbed. Rice normally takes around 20 minutes to become tender.
  2. Then take a large-sized bowl in which you bring together the rice and butter. Now it’s time to fold in barberries, dill, shallot, and lemon juice. You can add seasoning over this. And there you go, your rice bowl is ready to be served.

5. Quinoa Salad with Nuts

An unusual Persian salad recipe that is nothing short of delightful and delicious with a nutty flavor.

Ingredients:

30g of coriander, chopped

4 tbsp of slivered almonds

300g of quinoa

50g of barberries

1 tsp of salt

2 tbsp of slivered pistachios

2 tbsp of olive oil (it should not be extra virgin as that tends to overpower the other flavors)

1 and half litres of boiling water

Some chopped mint

Method:

  1. Place the quinoa in your sieve to rinse the whole thing using running water. Then pour boiling water over it on a medium-sized saucepan. You can add salt now and stir it well. Let it cook on medium heat until the quinoa is cooked through. Then you can drain it.
  2. Dry the barberries after rinsing them with the use of kitchen paper.
  3. Add a tbsp of olive oil to a saucepan to toast the slivers of almond over medium flame. Then you can bring in the slivered pistachios along with the remaining olive oil and barberries. Cook all of this till the barberries become shiny and puffed.
  4. Remember to keep aside a tbsp of along with the chopped herbs and nut mix for the end. Mix the remaining ingredients with the quinoa. Set it on the pot over low heat. Cook the covered pot for not more than 10 minutes.At the end of which you will see steam rising. Once that happens, it’s time to transfer the dish onto a serving plate before fluffing it using the fork.
  5. You can sprinkle some olive oil and black pepper over this. And now is the time to bring in the chopped herbs, nut mix, and barberries. And next all you have to do is enjoy the dish!

6. Simple Easter Cake

When you have an ingredient as flavorful as barberries, you can think of many clever ways to use it for all kinds of foods. Including this sweet and simple cake.

Ingredients:

150g of butter

125g of hazelnuts

1/2 tsp of vanilla powder

100g of sugar

3 eggs

1 tsp of baking powder or tartar cream

25g of dried barberries

150g of wheat flour

Some salt

For glaze:

100g of dark chocolate

Method:

  1. Preheat your oven to 340 degrees Fahrenheit.
  2. Grease as well as flour a Bundt pan measuring 6 inches.
  3. Then you need to toast all the hazelnuts in the oven for not more than 10 minutes. Keep them aside to cool. From this batch, collect 10g of hazelnuts to grind them. The rest will be used later.
  4. Blend together vanilla, sugar, and butter until you get a light creamy paste. Then pour this into a mixer and add the eggs.
  5. In another bowl, bring together the baking powder or tartar cream, flour, and salt. Then add this to the batter you prepared in the mixer earlier. Blend it well before adding grounded hazelnuts along with dried barberries. Use a spatula to mix all the ingredients.
  6. Now is the time to pour the batter onto the pan. Make sure that the top layer is nice and smooth before you bake the sweet dish for 35-40 minutes. At the end of which remove it from the pan and transfer it to a wire rack.
  7. Meanwhile, prepare the toppings. You can now chop the remaining hazelnuts. Then use the potato peeler to create dark chocolate curls of a single bar of chocolate.
  8. Once the cake cools down on the wire rack, it’s time to place parchment paper under it.
  9. Melt some chocolate with hot water and spread it all on top of the cake. Make sure that some of it drizzles along the sides.
  10. Finally, garnish the cake with the dark chocolate curls, chopped hazelnuts, and barberries. Once the glaze becomes hard completely, it’s time to dig into the cake.

Wrapping It Up

is a powerful natural food that won’t work unless you consume it on a daily basis. It’s so effective and reliable that it helps reduce metabolic diseases, accelerates fat metabolism, and is good for maintaining normal blood pressure levels.

Berberine, present in , is a nutritive bioactive compound with a wide range of health benefits. It’s considered good for improving insulin resistance, diabetes, high blood sugar levels, and autoimmune diseases. Other health markers such as infections, heart diseases, high LDL cholesterol, and such are all affected by a regular berberine intake.

So since it’s such a powerful substance with life-changing properties, why won’t you consume lots of it?

Health Benefits of Zinc

Zinc is what is known as an essential mineral. Zinc is naturally occurring in certain foods, added to others and is available as a supplement. Zinc is pivotal for proper immune function and cell division. Zinc is located primarily in the red and white blood cells as well as the liver, bones, pancreas, kidneys, skin and the retina of the eye.

A zinc deficiency can lead to various health defects and can even result in premature labor in pregnant women. A few signs and symptoms of a zinc deficiency include but are not limited to:

  • White spots appearing on your fingernails
  • A drop in blood pressure
  • Retarded growth
  • Mood swings and feelings of depression
  • Feeling constantly tired and fatigued
  • Hair beginning to fall out
  • Diarrhea
  • Loss of or poor memory
  • A drop in sex drive/low libido
  • Wounds taking a long time to heal
  • Dulling of the senses of taste and smell
  • Trouble with falling and staying asleep

A zinc deficiency is often difficult for doctors to diagnose (due to serum or plasma zinc levels not giving an accurate measurement of zinc in the body) so noting the symptoms is important.

People over the age of 60 and those who eat a vegetarian diet are more likely to become zinc deficient.

1. Zinc Can Improve Your Sense Of Taste And Smell

Hyposmia is a condition in which you begin to lose your sense of smell. Without the healthy amount of zinc in our bodies our sense of smell will begin to fade (1).

Smell and taste are very closely linked and are both needed to taste food properly, in fact it is often the case that you are experience a dulled sense of taste due to a lacking sense of smell.

A healthy amount of zinc can be used to hypogeusia (the loss of the sense of taste) (2).

2. Zinc Stimulates The Activity Of white Blood Cells

White blood cells are also known as leukocytes are imperative to the healthy functioning of our immune systems. Your white blood cell count is important as white blood cells help the body fight off illness and infections due to its ability to attack germs, bacteria and viruses that have entered the body. Having your white blood cell count tested can also indicate whether or not you are suffering from any undiagnosed medical conditions or undetected infections.

Causes of a low white blood cell count include suffering from an overactive spleen, exposure to radiation, a severe vitamin deficiency and rheumatoid arthritis. Symptoms can include fatigue and feeling weak and short of breath.

Zinc is vital to ensuring the health of white blood cells. Zinc is the key to stimulating for aggressive fighting action from white blood cells. Zinc also raises the number of killer white blood cells in the body. These killer cells stimulate extra antibody production from the body’s white blood cells. Zinc supplements have even been shown to slow the growth rate of cancerous cells (3).

3. Zinc Is Useful For Fertility And Pregnancy

Zinc is a powerful weapon in helping couples conceive (4). Zinc has advantages for the health of both women and men when it comes to fertility.

A zinc deficiency in men has been linked directly to impaired sperm production. A zinc deficiency could also result in negative chromosomal changes to the sperm that could result in a miscarriage. Without zinc the tail and the outer membrane of the sperm cannot develop properly. When these parts of the sperm do not develop, the sperm does not have the ability it needs to journey from the man’s epididymis all the way through the woman’s cervix and to the uterus for fertilization to be completed (5).

In women, zinc is needed for hormones like estrogen, testosterone and progesterone to remain balanced which is key for fertilization. Zinc is also needed for eggs to mature healthily and for maintaining proper levels of follicular fluid without which the ripe egg cannot make the journey out of the fallopian tubes into the uterus where it will wait for implantation (6).

Zinc plays an important part during pregnancy as it needed for the baby’s DNA production and function as well as cell growth (7). Zinc during pregnancy is needed for healthy brain function in babies and ensure future brain development and learning (8). A growing fetus uses zinc to change protein to tissue which is needed for the building of muscle (9).

4. Zinc Can Treat Prostate Disorders

Statistically 1 in 7 men will unfortunately suffer from prostate cancer. It is one of the leading causes of fatality in men the world over.

Research shows that zinc, which is a trace mineral, plays a role in overall prostate health (10). Prostate cells actually hold a higher level (10 or 15 times higher) of zinc than any other cells within the human body.

The reason that zinc helps against prostate cancer is because it enables prostate cells to resist transforming in malignant cells because it creates an environment that is toxic to cancerous cells. Zinc is a tremendous tumor suppressor. Zinc activates the process of apoptosis which is a cell death mechanism that is a self-protection mechanism the body uses to eliminate potentially damaging cells.

Cancerous prostate cells have very low levels of zinc compared to healthy prostate cells. This is due to prostate cancer cells not being able to accumulate any zinc.

A study has shown that men who were given over 15 milligrams of zinc had a reduction in the risk of advanced prostate cancer development by up to 66 percent (11).

5. Zinc Can Regulate Diabetes

Diabetes (also known as diabetes mellitus) is a disease that you develop when blood sugar levels within the body are too high. The diabetes disease prevents the body from producing or using insulin which is key in the body’s process of changing glucose into usable energy. Thousands of people are currently living with undiagnosed diabetes.

Zinc is a good regulator of diabetes as it has been shown to mimic insulin when introduced into insulin-sensitive tissues. Zinc also stimulates the action of insulin (12). Zinc binds itself to the body’s insulin receptors and participates in the activation of insulin signalling pathways. Zinc is ultimately responsible for the body’s cells taking in insulin and keeping excess insulin out of our blood. Diabetic patients very often exhibit signs of insulin deficiencies.

A study carried out in Finland followed over a thousand adults living with type 2 diabetes over a duration of seven years. During the seven year study 254 participants suffered from either non fatal or fatal heart attacks whilst 156 of the participants passed away due to heart disease. The zinc levels in all of the participants who suffered from or died from heart disease or attacks were noticeably low compared to the participants who did not have any heart complications (13).

Systolic blood pressure can also be reduced with zinc supplements. Zinc supplements also ensure optimal lipid parameters (14).

Zinc is prescribed to patients who are unable to control their diabetes (15).

Zinc is a natural anti inflammatory and because of this it helps to clear out any substances that cause cell inflammation. This action by zinc helps to preserves the health and insulin sensitivity of the cells (16). One Spanish study found a direct link between low levels of zinc and higher glucose intolerances and lowered insulin resistance.

6. Zinc Improves Your Metabolism

Our metabolisms work because our body contains cells which are full of enzymes that break down the food we eat. After enzymes break the food down it is changed into energy that is in turn used to keep our hearts beating and to keep our limbs moving among so many other uses.

One way in which zinc boosts our metabolisms is because it raises levels of leptin within our bodies. Leptin is a hormones that tells the brain that we are full. Higher levels of leptin keep our appetites in check and prevent us from overeating (17).

Studies show that people suffering from obesity have incredibly poor levels of zinc in their systems. The same obese patients that were administered zinc supplements over time exhibited a healthy decline in their body mass indexes (18).

7. Zinc Can Prevent Alopecia

Alopecia is a disease in which the loss of hair is the main symptom. There are three kinds of alopecia. Alopecia totalis is characterised by loss of the entirety of the hair on the head, alopecia areata is characterised by loss of hair occurring in patches and lastly alopecia universalis which is characterised by a loss of hair over the entire body.

Alopecia (an autoimmune disease) occurs when our immune systems turn on and start attacking healthy hair follicles. Around 5 percent of the world’s population will suffer from one form of alopecia and whilst some hair does sometimes grow back, some people may never regain hair growth. Alopecia is mostly caused by someone’s genetic makeup. Symptoms of alopecia include;

  • Bald patches beginning to appear, usually brought to attention by clumps of hair falling out of the head
  • Pitting of the fingernails, meaning that small dents begin to appear on the fingernails
  • Thin fingernails, white spots appearing on fingernails and rough and or splitting fingernails (fingernails may loosen and fall off in extreme cases)
  • Hair loss mainly at the back end of the scalp

Zinc being on of the most important trace minerals found in the body plays a big role in the cycle of hair growth. Without zinc, hair follicles would not be able to produce fresh hair shafts during this growth cycle. Sometimes the zinc levels drop so low in the body that a condition called telogen effluvium is triggered (19).

Telogen effluvium is when hair roots are prematurely pushed into a state of rest usually due to stress. When telogen effluvium occurs we begin to shed hair at a rapid rate. This condition can last for up to a year and cen even become chronic.

Zinc is usually prescribed in conjunction with biotin to treat alopecia. Zinc as an antioxidant protects the hair follicles from damage inflicted by free radicals which is important for anyone suffering from alopecia as their immune system is compromised (20).

A zinc deficiency can our hair follicle’s protein structure which weakens the hair follicles (21). When the structure of hair follicles is weakened hair will fall out more easily. Studies carried out on rats have also shown that zinc plays an important role in the regrowth of hair. Zinc plays a role in RNA and DNA production which also lends itself to strengthening hair and people who take zinc supplements have also noticed a change back from grey hair to their natural color.

8. Zinc Strongly Impacts Your Mental Functions

Zinc is a known regulator of communications between the hippocampus and neurons in the brain, an action which improves our learning capabilities and memory. Including healthy amounts of zinc in our diets can stave off the cognitive decline that comes with old age (22). Zinc has also been found to play an integral role in cognitive stability and the formation of memories.

A study on mice at Duke university removed all zinc from the brains of the mice and noted a significant decline in the communication between neurons in the brain. An absence of zinc in the brain of the test animals stopped advanced communication and upon reintroduction of the mineral, enhance communication, memory and improved learning were restored to the hippocampal region.

A study proved that people who were losing zinc were often disoriented and struggled with memory loss, much like someone suffering from age related senility. When zinc was reintroduced into the patient’s systems their normal mental and ability and function quickly returned (23).

Tests also confirm that people living in developing countries suffer from mental loss at a much higher rate than people living in developed countries, this is due to zinc not being as readily available in the diets of people living in poorer countries.

9. Zinc Can increase The Healing Rate Of Wounds

Zinc is a powerful healer as it plays a role in cell division, the inhibition of bacterial growth, protein synthesis, DNA synthesis, immune response and the maturation of T-lymphocytes (white blood cells) (24).

Zinc speeds up the rate at which the skins heals whilst protecting the wound from any bacteria buildup and infection. Zinc is required for cellular metabolism (the chemical reactions that are continuously occurring in order to keep us alive). Zinc works to maintain the structure of mucosal membranes and dermal tissue (25).

10. Zinc Can Alleviate Chronic Fatigue

The disorder chronic fatigue syndrome is when you feel constantly tired no matter how much rest you get. The causes of this debilitating disorder are not clear and can range from psychological stress to viral infections. This disorder is not well understood so can be difficult to treat. A few symptoms of chronic fatigue syndrome include;

  • Having trouble with recalling information
  • Insomnia
  • Struggling to concentrate
  • Pain in the joints
  • Frequently suffering from a sore throat
  • Swelling and tenderness in the lymph nodes
  • Muscle pains
  • Frequent headaches
  • Feeling unrested after a full night’s sleep

Zinc has a profound effect on our immune systems and is present in some quantity in every single cell of the body. Zinc works well for fatigue as our body would not be able to utilize the vitamins we receive in our diets to the fullest without it (26). When your body does not fully absorb vitamins and nutrients, you are left with a weakened capacity for the production of energy resulting in being constantly fatigued.

11. Zinc Is Useful For The Prevention Of Acne

Acne occurs when the sebaceous gland found in the skin become infected or inflamed resulting in pimples or in extreme cases welts mainly on the face. Acne can be painful, embarrassing and expensive to treat.

A study carried out in Turkey found that participants suffering from acne had much lower levels of zinc than those who did not have acne. A dozen studies have all shown that zinc supplements have a positive effect on eliminating acne (27).

Zinc attacks and kills the bacteria that is responsible for acne and reduces keratinocyte activation. Keratinocyte cells are responsible for the production of keratin (the protein our hairs and nails are made of which also binds or skin cells). When we have too much keratin, it stops skin cells separating and results in blocked pores which causes acne.

12. Zinc Supports The Health Of Your Liver

Our liver is the largest gland in our bodies and supports to some extent in the work of every other organ.

Zinc deficiencies have been directly linked to cirrhosis of the liver (when healthy liver tissue is replaced with scar tissue) and various studies have shown that a healthy amount of zinc in the body can protect us from developing chronic and acute liver diseases (28). Zinc is a natural antioxidant and in animals trials has shown the ability to protect the liver from oxidative damage.

13. Zinc Can Prevent Diarrhea

Diarrhea is an increased and uncontrollable discharge of fecal matter in liquid form from the body. Diarrhea is the number one cause of mortality in children under the age of five.

We need zinc for cellular differentiation, metabolism and growth all which increase our body’s strength against possible infection which can reduce the severity and duration of diarrhea (29).

Zinc supplements can also reduce the likelihood of infections that may be introduced into the body during the period of diarrhea (30).

14. Zinc Can Be Used To Fight Eczema

Eczema is a chronic skin condition in which the skin becomes inflamed, flaky and itchy (usually a rash covering the skin on the hands, face, feet or back of your knees). Eczema (also known as atopic dermatitis) affects mostly children and those suffering from eczema often develop further allergic condition like hay fever and asthma.

Zinc is used to treat eczema as it soothes skin that has become inflamed (31). Eczema is some cases caused by leaky gut syndrome which is a condition which results in large amounts of zinc being excreted from the body (32).

15. Zinc Can Prevent Night Blindness

Night blindness is the loss of the ability to see accurately in the dark or reduced light and is usually a symptom of a problem in the retina of the eyes.

Vitamin A is largely responsible for the health of the eyes but without healthy zinc levels in our systems our body is unable to use vitamin A correctly. Zinc paired with vitamin A has much better effects on night blindness than vitamin A alone (33).

15 Best Zinc Foods

Garlic

Garlic being used for health benefits stretches 3000 years back to, it was also used in World War I to treat wounds as it works as an antiseptic. Garlic is a good source of sulphur, iodine, chlorine, calcium, iron and phosphorous.

Garlic can treat eye infections and ear aches. Both raw and cooked garlic have antifungal, antibiotic and antiviral properties. The quercetin, vitamin C and selenium found in garlic help to reduce swelling brought on by eye infections.

Colitis, dysentery and diarrhea are all intestinal problems that can be cured with garlic. Garlic destroys all the potentially harmful bacteria that builds up in the gut whilst leaving the helpful gut bacteria untouched. Garlic is also a useful tool for expelling intestinal worms. Garlic aids the natural work of our intestines which results in smooth bowel movements.

Consuming garlic reduces platelet aggregation (platelets are blood cells and platelet aggregation is when these blood cells begin to cling to each other) which reduces the risk of thrombosis (when a blood clot begins to form within a blood vessel and causes and obstruction of blood flow).

Watermelon Seeds

Watermelon seeds are a great source of protein. Just one cup of seeds can provide you with over 60 percent of the recommended daily intake of protein. The protein found in watermelon seeds are made up of varying amino acids, one of these being arginine. Arginine has a multitude of benefits including working to treat coronary heart disease and regulating blood pressure within the body.

Watermelon seeds are incredible rich in magnesium. Magnesium has a calming effect on people suffering from anxiety or nerves. Magnesium boosts the production of an acid called gamma-aminobutyric. When this acid is in low quantities in the brain feelings of unease and worry become heightened. Magnesium also clears the brain of metal build up which can also result in anxiety.

Magnesium can be used as a sleep aid as it promotes healthy sleep cycles. It also works to prevent migraines, keep a healthy pregnancy, ease muscle aches and spasms and regulates calcium within the body (makes sure that calcium is sent to the bones to build new stronger bone instead of collecting in the arteries and blood vessels where it could create blood clots).

Watermelon seeds contain lycopene, an antioxidant that works to protect our bodies from multiple disease caused damages. Lycopene is also good for improving fertility in men.

Chickpeas

Chickpeas provide twofold heart health benefits. Chickpeas contain omega-3 fatty acids, a healthy polyunsaturated fat that is vital to overall health, which reduces inflammation and promotes heart health. Chickpeas are also high in soluble fibre which strips cholesterol from the heart, arteries and blood vessels minimising the risk of clot formation.

Chickpeas contain folate. Folate is known for protecting against birth defects and is an important supplement during pregnancy. When folate levels dip during pregnancy there is a high risk of neural tube defects.

Chickpeas are a legume and also a complex carbohydrate. Complex carbohydrates are digested very slowly by the body and keep blood levels in a healthy range unlike simple carbohydrates that result in a sudden spike in blood sugar followed by a large drop. Being a complex carbohydrate makes chickpeas a good food choice for those suffering from diabetes.

The fibre content in chickpeas are good for our digestive systems. Fibre pulls out water from within our bodies and adding them to the stool being formed adding bulk and resulting in smoother bowel movements. This can lower instances of constipation and irritable bowel syndrome. Fibre also balances bacteria and pH levels in our guts.

Oysters

Oysters are considered an aphrodisiac (a food which boosts sexual desire and performance) and this is due to the incredibly high levels of zinc found in oysters. Low levels of zinc are thought to be responsible for erectile dysfunction and impotency in men.

The iron present in oysters has great health benefits for your energy levels. Iron is absolutely crucial to the body’s red blood cell formation. Red blood cells are the cells that carry oxygen throughout the body to our organs. More fresh red blood cells result in organs receiving higher volumes of oxygenated blood which increases their activity. Iron is also the body’s number one defense against a anemia. Anemia occurs when the body becomes crucially low on iron and the symptoms can include;

  • Feeling very weak or fatigued
  • Cognitive malfunctions
  • Feeling dizzy
  • Shortness of breath or trouble breathing
  • A tingling sensation in the legs
  • Craving strange things like clay or soil
  • Losing colour in the skin
  • A swollen or sore tongue

Just one serving of oysters can give you up to 90 percent of your daily iron recommendation.

Cashews

Cashews contain oleic acid, an acid that has shown benefits for those suffering from diabetes or prediabetes as it improves blood circulation, insulin sensitivity and fasting plasma glucose (blood sugar).

Many people avoid eating too many nuts because of the fats they contain but these fats are very heart healthy! Cashews contain polyunsaturated fats and monounsaturated fats without which our bodies would not be able to efficiently absorb fat soluble vitamins such as vitamins D, A, E and K.

Cashews are high in minerals, particularly copper, and can ensure that the healthy balance of minerals in your body stays stable. Just one serving of cashews provides you with over 30 percent of your daily recommended intake of copper. When you are copper deficient you may experience the following symptoms;

  • Osteoporosis (brittle and weak bones)
  • Pale skin
  • Poor circulation of blood
  • Sudden and unexplained weight loss
  • Stunted growth
  • Feeling tired and weak
  • Pain in the joints and or muscles
  • Arthritis
  • Dilated veins
  • Thyroid disorders
  • A drop in your count of white blood cells

Copper works hand in hand with melanin to provide coloration to our skin, eyes and hair. Incorporating copper into your diet can help stave off grey hairs. Copper is vital for the synthesis of myelin (a white, fatty substance the covers the nerves), collagen and hemoglobin (protein present within red blood cells responsible for carrying oxygen). Copper also helps the body produce elastin which works with connective tissues to keep your skin flexible.

Copper has brain health benefits and when ingested in the correct amounts can result in more effective thought processes.

Beef

Beef is an important source of protein. Every organ in your body needs protein to function as it should. Red meat is also rich in iron, zinc, vitamins B12, B6 and vitamin D.

Mushrooms

Mushrooms contain an antioxidant called ergothioneine. Ergothioneine works to protect our immune systems from damage caused by free radicals (a molecule with unpaired electrons which damages cells) and to boost the overall health and stability of it. Mushrooms are also full of natural antibiotics which work similarly to penicillin which work to inhibit fungal infections and microbial growth. These natural antibiotics also speed up the healing of ulcerous wounds and protect these wounds from the development of infections.

Mushrooms are a good source of the trace mineral selenium. When our bodies are selenium deficient we are at danger of developing Keshan disease. Keshan disease regularly leads to myocardial necrosis which weakens the heart. A selenium deficiency can also cause Kashin-Beck disease which leads to necrosis (cell damage) of cartilage tissue within our joints.

Selenium increases blood flow within the body, works to combat coronary heart disease, fights inflammation and reduces oxidative stress caused by free radicals. Selenium is mostly found in animal proteins so mushrooms are a great food based source of the mineral for vegans and vegetarians.

Mushrooms have a high protein content, are low in carbohydrates, contain fibre, water, various minerals and vitamins and are completely devoid of cholesterol and fats. All this together makes mushrooms a perfect food for diabetics.

Shrimp

Shrimp are chock full of minerals and vitamins. Shrimp contain calcium, sodium, magnesium, zinc, phosphorous, potassium, iodine, thiamine, niacin, riboflavin and vitamins E, A, B12 and B6.

The vitamin A present in shrimp controls the development of red blood cells. The vitamin A works to stimulate genes that developing cells need to transform from being stem cells to being mature and functioning red blood cells. Vitamin A also allows red blood cells to gain access to iron needed for oxygen transportation.

Shrimp are rich in astaxanthin, a carotenoid which acts as a potent antioxidant, reducing skin damage (aging) caused by prolonged direct exposure to UV rays.

Shrimp can be used to fight age related macular degeneration. Age related macular degeneration is when an area of your retina known as the macula becomes damaged and is the leading cause of eye damage and blindness worldwide. Astaxanthin and the heparin-like compound present in shrimp help to protect against age related macular degeneration and can relieve eye fatigue that some people suffer from due to work involving looking at computer or TV screens for extended periods of time.

The magnesium, phosphorous, calcium and protein found in shrimp all contribute to maintaining bone health.

Brown Rice

Brown rice is rich in powerful antioxidants. The antioxidant enzyme in brown rice known as superoxide dismutase keeps cells protected against oxidation damage which typically occurs during the production of energy. Brown rice has been shown to be superior to white rice in preventing oxidation-mediated diseases (heart disease).

The high fibre and antioxidant content of brown rice also makes it a potent anti cancer food. Brown rice has been shown to be able to help prevent leukemia, breast cancer and colon cancer. Fibre binds itself to toxins that cause cancer which renders these toxins unable to attach themselves to your colon wall.

The manganese and vitamin B found in brown rice can keep the brain’s cognitive function running smoothly. Brown rice also contains magnesium which acts as a calcium regulator, keeping calcium in the bones and out of nerve cells. The gamma-aminobutyric acid in brown rice combats the onset of neurodegenerative diseases including Alzheimer’s disease.

Egg Yolks

Egg yolks are often omitted and only egg whites used in an effort to lose weight, but the vast majority of vitamins that eggs have to offer are found exclusively in the egg yolks. Vitamins A, D, E, K, B6, B12 and folate are all found in egg yolks. Minerals found in eggs include magnesium, selenium, iron, potassium, calcium and sodium.

Egg yolks contain the macronutrient choline. Choline supports brain development, nerve function, movement of muscles, liver function, energy levels and keeps a healthy metabolism. Choline is especially important for pregnant and breastfeeding women. A choline deficiency could result in the following symptoms;

  • Feeling fatigued
  • Loss of memory
  • Decline in cognitive function
  • Damage to nerves
  • Mood disorders or sudden mood changes

One large egg can supply you with nearly 150 milligrams of choline.

It is true that egg yolks are high in cholesterol but they also raise the level of HDL (high density lipoprotein) cholesterol which is known as the good cholesterol.

Egg yolks also contain zeaxanthin and lutein, both of which help to protect the eyes against the onset of cataracts (when the lens of the eye becomes clouded and vision becomes blurred).

Turkey

Turkey is a great source of protein and contains a very small amount of fat.

Turkey contains niacin or vitamin B3. Niacin plays a role in normalising our digestive systems. Niacin is a useful tool in combating erectile dysfunction and a low libido. Niacin reduces levels of LDL cholesterol (the bad cholesterol) and raises levels of HDL cholesterol (the good cholesterol), this aids in protecting the body from diseases like atherosclerosis (a disease where LDL cholesterol build up results in the narrowing and hardening of the arteries).

Turkey is a good source of the essential amino acid tryptophan. Tryptophan boosts serotonin production and is used to treat anxiety, depression, sleep apnea, insomnia and premenstrual dysphoric disorder, among other disorders.

Peas

A single cup of peas contains up to 10 milligrams of coumestrol. Coumestrol is a polyphenol that has been shown to be able to protect against stomach cancer.

Peas are a rich source of anti inflammatory phytonutrients, those along with the vitamins, omega-3 fatty acids and minerals present in peas help peas to prevent candida (fungal infection), bronchitis, wrinkles, alzheimer’s and osteoporosis.

Dark Chocolate

Dark chocolate is full of copper and magnesium which regulates heart rhythm and blood pressure. Dark chocolate also enables blood vessels to be more flexible and maximises endothelial cell (cells making up the lining of blood vessels) which allows for better blood circulation. Polyphenols in dark chocolate also contribute to keeping your vascular health.

Consuming a healthy amount of dark chocolate can lower cholesterol levels in the body anywhere from 10 to 12 percent.

Those suffering from anemia can find relief by consuming dark chocolate due to the flavonoid compounds it holds. Dark chocolate also contains serotonin and antioxidants.

Pumpkin Seeds

Pumpkin seeds are an excellent source of omega-3 fatty acids that are plant based, which is a good way for vegetarians and vegans to get this important oil into their diets. Omega-3 fatty acids can sooth symptoms of anxiety, ADHD, arthritis, cardiovascular disease and improve hair and skin quality, fertility, diabetes and aid in weight loss.

Pumpkin seeds contain phytoestrogens which can decrease the joint pains, hot flashes and changes in blood pressure some women experience due to being premenopausal.

Pumpkin seeds contain the amino acid (amino acids are protein building blocks) tryptophan which is converted to serotonin upon entering the body. This serotonin is then changed to melatonin which is a hormone that ensure restful sleep and regular sleep cycles.

Beef Liver

Beef liver is high in vitamin A. When your body is vitamin A deficient you may experience a drop in the strength of your immune system as it is vital for white blood cells to grow normally. Beef liver is also incredibly rich in iron and vitamin B12.

Sulforaphane (broccoli extract) slashes diabetics’ blood sugar

Doctors frequently tell us to eat our greens, but soon they could be prescribing broccoli. A powder that contains concentrated extract from the vegetable could prove indispensable to people with type 2 diabetes. The extract reduced blood sugar levels by up to 10 per cent in people with the disease.

Type 2 diabetes usually develops around middle age, often in people who are overweight. Their body stops responding to insulin, which controls the level of glucose in the blood. Abnormal insulin regulation causes a rise in blood sugar levels, which can raise people’s chances of heart attacks, blindness and kidney problems.

People with the condition are often prescribed metformin, which helps to lower blood glucose. However, as many as 15 per cent cannot take this therapy because of kidney damage risks.

“More research is needed to see if this repurposed drug can be used to treat Type 2 diabetes, as it was only tested in a small number of people and only helped a subset of those who are taking it,” says Elizabeth Robertson, of the charity Diabetes UK. “For now, we recommend that people continue with the treatment prescribed by their healthcare team.”

Clever greens

A chemical called sulforaphane, found in broccoli sprouts, has previously demonstrated an ability to reduce glucose levels in diabetic rats. Anders Rosengren of the University of Gothenburg in Sweden, and his colleagues wondered whether the same might be true for humans. To test the theory, his team gave 97 people with type 2 diabetes a concentrated dose of sulforaphane every day for three months, or a placebo. All but three people in the trial continued taking metformin. Those who didn’t take metformin were able to control their condition relatively well without it.

The concentration of sulforaphane given was around 100 times that found naturally in broccoli. “It was the same as eating around five kilograms of broccoli daily,” says Rosengren.

 

On average, those who received the broccoli extract saw their blood glucose reduce by 10 per cent more than those on the placebo. The extract was most effective in obese participants with “dysregulated” diabetes, whose baseline glucose levels were higher to start with.

“We’re very excited about the effects we’ve seen and are eager to bring the extract to patients,” says Rosengren. “We saw a reduction of glucose of about 10 per cent, which is sufficient to reduce complications in the eyes, kidneys and blood,” he says.

 

Complimentary medicine

Further investigations showed that while both metformin and sulphoraphane cut blood glucose, they do it in different ways. Metformin makes cells more sensitive to insulin, so they sponge more surplus glucose out of the bloodstream. Sulphoraphane reduces glucose by suppressing liver enzymes that otherwise stimulate the production of glucose.

For this reason, Rosengren thinks the broccoli extract is complementary to metformin, not competitive. But he points out that many people with diabetes can’t take metformin because of kidney complications, so the broccoli extract could be an ideal substitute in these cases.

In collaboration with the Swedish Farmers’ Association, Rosengren and his colleagues are applying to regulatory authorities to seek approval for the powder, which could take as little as two years.

Rosengren also plans to explore potential benefits of the extract in people who are pre-diabetic, and so not yet taking metformin.

Journal reference: Science Translational Medicine, DOI: 10.1126/scitranslmed.aah4477

 

 

How to use Berberine to Boost Weight Loss, Lower Blood Sugar & More

 

Berberine might just be one of the best supplements you’ve never heard of.

Elevated blood sugar levels damage the body’s tissues and organs leading to a variety of health problems, poor quality of life, and shortened lifespan.

We strongly believe a low carb diet like the Keto diet, along with increased exercise is the most effective means of combatting high blood sugar, metabolic syndrome, diabetes and related disease.

However, many people are not able to control their blood sugar levels with diet and exercise alone and turn to prescriptions medications from their doctor.

The most commonly used prescription drug for high blood sugar is metformin (Glucophage)

Works as well as Metformin
A review of the 14 most relevant studies that found berberine works as well as the most commonly prescribed diabetes drugs metformin, rosiglitazonem and glipizide (10, 11,15).

Berberine seems to work via multiple different mechanisms (12):

  • Decreases insulin resistance, so it is more effective at lowering blood sugar levels
  • Increases glycolysis inside the cells
  • Signals the liver to decrease glucose production.
  • Slows the breakdown of carbohydrates in the gut.
  • Increases the number of beneficial bacteria in the gut.

Remarkable as it seems that it acts in all these pathways, also seems to affect various other enzymes, molecules and genes related to blood sugar control.

Normalized Blood Sugar Levels
116 diabetic patients given 1 gram of berberine per day for 3 months.

These patients experienced fasting blood sugar levels lowered to normal levels, from 126 to 101 mg/dL (13).

Lowers Bad Cholesterol Levels
These same 116 patients experienced A1c levels lowered by 12% on average, and greatly lowered levels of cholesterol and triglycerides.

Triglyceride decreased from 2.51 to 1.61, total cholesterol from 5.31 to 4.35, and LDL cholesterol. from 3.23 to 2.55 mm/liter. (14).

 

Berberine has been found to work well with other interventions such as reduced calorie diets and exercise, and has synergistic effects when taking with other diabetes medications (16).

Conclusion: Berberine is very effective at lowering blood sugar level

INCREASED NAD+ AND AMPK – THE METABOLIC MASTER SWITCH

ampk enzymeWhen ingested, it travels thru the blood to cells and binds to several different molecules to actually change their function (5). This is similar to how pharmaceutical drugs work.

The different mechanisms of berberine are complicated, but one of the main functions is to activate the AMPK enzyme (6).

Referred to as a “metabolic master switch” (6), AMPk is found in the cells of the brain, muscle, kidney, heart and liver. It helps regulate metabolism (7, 8).

Berberine also affects other molecules in the cells, and is even thought to determine which genes in the cells are turned on or off (9).

This study showed the activation of AMPK resulted in increased NAD+ levels, mitochondria biogenesis, weight loss, and increased muscle fibers.

Further exploration of the mechanism that berberine and metformin utilized for elevating AMPK and NAD+ was shown in this study.

Conclusion: Berberine acts at the molecular level activating the AMPK enzyme, which increases metabolism.

Berberine and Weight Loss

weight loss chart

2 recent studies found positive results for weight loss with supplementation of Berberine.

In a 12 week long study of obese individuals that were given 500 mg of berberine 3 times a day, they lost an average of 5 pounds, and 3.6% of their body fat (17).

The second study was for 3 months, during which 37 individuals with metabolic syndrome were given 300 mg of berberine 3 times per day. These patients saw their body mass index (BMI) drop from 31.5 to 27.4, lost significant amounts of belly fat, and saw improvement in several other markers of health (18).

Improved insulin resistance and regulation of hunger hormones adiponectin and leptin were believed to be responsible for the positive results in this study.

Other studies at the molecular level have shown Berberine changes the expression of PPARgamma2 mRNA genes to inhibit formation of adipocytes (fat cells) (19, 20).

Conclusion: Studies have shown that berberine can cause significant weight loss, belly fat, improve BMI and other health markers.

 

wwrecommend

SIDE EFFECTS and DOSAGE

As fantastic as Berberine is, the main problem it has is bioavailability. One of our bodies main defense mechanisms, P-Glycoproteins, bind with foreign objects in the small intestine and carries them away.

Unfortunately it does a great job of stopping the absorption of beneficial plant based compounds like Curcumin and Berberine. The result is very low absorption rates of 5% or less, meaning we have to take a LOT more than what our bodies actually use.

Your body has to process and excrete a LOT of Berberine

Too much Berberine can lead to mild side effects such as:

  • gas
  • cramping
  • bloating

These minor discomforts appear at higher dosages only, so you should start slowly and work your way up

Also, some potential interactions with other medications:

  • Berberine is known to inhibit CYP2D6, CYP2C9, and CYP3A4, which can lead to a host of drug interactions, some of which can be serious
  • Berberine may interact with microlide antibiotics such as azithromycin and clarithromycin at hERG channels on the heart, leading to serious cardiotoxicit

Most research has used 4-500mg dosage, taken 2 -3 times a day.  Higher dosages are more effective, but tend to result in more Gastro-Intestinal issues.

Improved Bioavailability

Higher bioavailability would allow a smaller dosage to get the same effect without risk of side effects.

The product we recommend above, Protocol for Life, uses MCT oil which has been shown to increase bioavailability and avoid GI issues (21,22,23)

 

Berberine has been used for thousands of years in Chinese and Native American medicine

chinese medicineBerberine has been used for centuries in Chinese medicine and by Native American Indians, yet has only recently been “discovered” by western medicine.

With our heavy emphasis on corporate profits driven by man-made, patented medicines, we often are late in learning about natural products such as Berberine and Niagen, but rest assured you will be hearing about it more in the future.

Berberine is now being studied extensively and has been proven to lower blood sugar as well as the most commonly prescribed prescription drug metformin (1, 2), aid in weight loss, improve heart health, and several other benefits (3)

patients had improved strength, and had lower blood pressure with declining blood glucose levels

Here are just some of the things research is now proving Berberine is able to help with.

  • Significantly Lowers blood sugar levels
  • Aids in Weight Loss
  • Improves Heart Health
  • Lowers Cholesterol
  • Decrease belly fat
  • Improve Immune System
  • Anti-oxident and Anti-Inflammatory
  • Lower Blood Triglyceride levels
  • Help fight Cancer
  • Fight Depression
Conclusion: Berberine has a long history of use for an amazing array of health issues that are now being “discovered” and used by western medicine

 

What is Berberine?

Berberine is the active ingredient in a several different plants that have been used in natural remedies for centuries, such as Goldenseal (Hydrastis canadensis), Oregon grape (Berberis aquifolium), Barberry (Berberis vulgaris), and Chinese Goldthread (Coptis chinensis) (4).

An alkaloid, it has a yellow color, and has often been used as a dye.

Berberine Lowers Cholesterol and May Reduce Your Risk of Heart Disease

Heart and Stethoscope
Berberine has been shown to improve many of the factors that lead to heart disease.

This review (21) of 11 different studies show that Berberine can:

  • Lower blood triglycerides by 44 mg/dL.
  • Lower LDL (bad) cholesterol by 25 mg/dL.
  • Raise HDL (good) cholesterol by 2 mg/dL.
  • Lower total cholesterol by 24 mg/dL.

Berberine also lowers apolipoprotein B by 13-15%, which is a big risk factor for cardiovascular disease (22, 23).

Conclusion: Berberine reduces cholesterol and triglyceride levels, while raising the good HDL cholesterol, and may lower the risk of heart disease.

 

Other Health Benefits

Berberine may also have numerous other health benefits:

  • Cancer:These studies (26, 27)
    seem to indicate that Berberine plays a role in reducing the growth of different types of cancer
  • Depression: These studies with rats (24, 25, 26) show that Berberine may lessen depression
  • Infections: These studies(27, 28, 29, 30)show Berberine fights harmful bacteria, viruses, fungi and parasites
  • Antioxidant and Anti-Inflammatory: These studies (31, 32, 33) indicate Berberine has strong antioxidant and anti-inflammatory effects
Conclusion: Berberine is a strong anti-oxidant and anti-inflammatory, and may help fight depression, infections, heart disease and even cancer

 

Side Effects

thumbs upOverall, berberine is very safe with the main side effects being indigestion, and possible cramping, diarrhea, flatulence, constipation and stomach pain (10).

An average dosage used in many studies are 900 to 1500 mg per day.

Berberine has a half-life of about 4 hours, so you do need to take it more than once a day.

It is common to take 500 mg, 3 times per day.

If you have a medical condition, you should speak to your doctor before taking berberine, especially if you are taking blood sugar lowering medications.

Conclusion: Some people may experience mild side effects with Berberine. The normal recommended dosage is 500 mg 3 times per day before meals.

 

The Bottom Line

There is no such thing as a magic weight loss supplement or medication.

There are however many medications and supplements that can help.

You just need to make sure that you are using the right dose for your body.

Berberine is one of very few supplements that are as powerful as a prescription drug.

It has numerous beneficial effects, most notably blood sugar control.

It is also be useful for general health, fighing chronic disease, and anti-aging.

If you need some help controlling your weight, blood sugar levels or want to improve your heart and overall health, Berberine may be right for you.

Remember that you may need to use berberine for as long as 6+ months to get the full benefit, and dosages up to 2,000mg per day may be necessary.

 

 

 

 

 

New Study that need to be folded in to this article

Berberine protects against diet-induced obesity through regulating metabolic endotoxemia and gut hormone levels.

1. Introduction
The human gut microbiota has recently been considered an important factor in modulating body health and might be closely associated with the pathogenesis of obesity, diabetes, inflammation, cardiovascular diseases, and other diseases [1-4].
Fecal microbiota transplantations have been used in clinics for the treatment of patients with chronic gastrointestinal infections and inflammatory bowel diseases because the intestinal bacteria release certain therapeutic metabolites that suppress inflammation in the gastroenterological tract [5-7]. For energy metabolism, gut bacteria could, for instance, benefit host metabolic efficiency by producing short-chain fatty acids (SCFAs) through bacterial fermentation [8].

Importantly, the nature of the gut microbiota, such as its composition, enzyme activity, and metabolite production, can be manipulated by controllable factors, such as drugs, diet, and lifestyle, offering a possible approach to treat diseases through regulating bacterial fermentation in the intestines. We focused our research on the metabolite profile of the gut microbiota after exposure to the botanical drug berberine (Berberine, Fig. 1A), and moreover, the metabolite’s production regulation.

SCFAs are small molecular weight compounds derived from the intestinal microbiota through fermentation of the fibrous diet and could be rapidly absorbed to enter the blood and organs [9, 10]. Chemically, there are 1–6 carbon atoms in SCFAs structures, which are presented in a straight or branched conformation [11]. The beneficial bioactivity of SCFAs includes those on energy metabolism, anti-inflammation, and immune regulation [2, 12, 13]. The major SCFAs are acetate, propionate and butyrate. Among these SCFAs, butyrate, which could be readily detected in feces and blood via gas chromatography (GC), is the primary energy source and has been widely documented with regard to human health (Fig. 1A & B) [14].

Bacterial butyrate is mainly synthesized through the acetyl CoA-butyryl CoA-butyrate pathway, in which the key enzymes are regulated based on the level of ATP and NADH [15, 16]. Chemicals that interfere with the ATP production or NADH level in bacteria might in turn regulate the level of SCFAs in intestinal microbiota.

We previously reported that Berberine (Fig. 1A) could safely lower blood lipid and glucose levels, and its therapeutic efficacy has been verified in clinics [17-21]. The mechanism of Berberine is different from that of statins [17, 22] and links to its regulatory effect on cellular targets such as low-density lipoprotein receptor (LDLR) [17], insulin receptor (InsR) [23], AMP-activated protein kinase (AMPK) [24], proprotein convertase subtilisin kexin 9 (PCSK9) [25], protein tyrosine phosphatase 1B (PTP1B) [26], mitochondrial ATP production [27], and brown fat tissue [28].

Thus, Berberine is considered a multi-target drug with significant advantages [22, 29]. Berberine administered orally enters the blood after a structural transformation by nitroreductases from bacteria in the gut [30]. However, the bioavailability of Berberine is poor and a large portion of it (over 90%) remains in the intestines [31, 32]. Recent studies have shown that Berberine might modulate the composition of the intestinal bacterial community [33], suggesting that the intestinal microbiota might also be involved in its regulation of energy metabolism.

In this study, we show that Berberine enriched butyrate-producing bacteria in the gut microbiota, and through the acetyl CoA-butyryl CoA-butyrate pathway Berberine promotes the gut microbiota to synthesize butyrate, which then enters the blood and causes a reduction in blood lipid and glucose levels. This mode of action—that is, working through the gut microbiota—appeared to be independent of the direct cellular mechanism of Berberine. We, therefore, speculated that regulating the production of bioactive metabolites in the gut microbiota might be a novel treatment strategy.

2. Materials and Methods
2.1. Chemicals and reagents
Berberine, butyric acid, sodium butyrate, valeric acid, isovaleric acid, and acetone were obtained from the J&K Scientific Ltd. (Beijing, China). Propionate acid, sodium propionate, acetic acid, and isobutyric acid were from the Sigma-Aldrich Co. (Shanghai, China). Tetrahydropalmatine (the internal standard) was purchased from the National Institute for Food and Drug Control (Beijing, China). The purity of the above standards was all over 98% in HPLC. Other chemical reagents from the Sinopharm Chemical Reagent Co., Ltd. (Beijing, China) were all at chromatographic grade purity.
Total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and fasting blood glucose (FBG) detection kits were obtained from the BioSino 7

Bio-technology & Science Inc. (Beijing, China). The ATP and NAD+/NADH assay kits were purchased from the BioAssay Systems (Hayward, CA, USA), and the rat AMP ELISA kit was obtained from the TSZ biological Trade Co., Ltd. (North Brunswick, NJ, USA). Acetyl-CoA and butyryl-CoA were both purchased from the Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China).
Cefadroxil was purchased from the National Institute for Food and Drug Control (Beijing, China). Terramycin and erythromycin were from the J&K Scientific Ltd (Beijing, China).

2.2. Animals
Sprague–Dawley (SD) rats (180–200 g, male) and hamsters (140–160 g, male) were supplied by the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences (Beijing, China). The ob/ob mice (40–50 g) were obtained from the Beijing HFK Bioscience Co. Ltd. (Beijing, China). Animals were housed in SPF-grade rooms and had free access to food and water, with a 12 h light/dark cycle (light on from 8:00 AM to 8:00 PM) at ambient temperature (22–24 C) and 45% relative humidity.
The research was conducted in accordance with institutional guidelines and ethics and approved by the Laboratories Institutional Animal Care and Use Committee of the Chinese Academy of Medical Sciences and Peking Union Medical College.
2.3. Instruments

Liquid chromatography with tandem mass spectrometry (LC-MS/MS 8050, Shimadzu Corporation, Kyoto, Japan) was used for the analysis and quantification of Berberine and its metabolites in biological samples. LC separation was achieved using a Shim-pack XR-ODS II column (75 mm × 3 mm × 2.3 μm, Shimadzu Corporation, Kyoto, Japan) maintained at 40 

C. The mobile phase consisted of water-formic acid (100:0.5, v/v) and acetonitrile with a linear gradient elution (0 min, 90:10; 3.5 min, 75:25; 5.0 min, 70:30; 5.01 min, 80:20; 6.0 min, 90:10) at a flow rate of 0.4 mL/min during the entire gradient cycle. Shimadzu LCMS solution (Version 5.72) was used for data acquisition and processing. For positive ESI analysis, the parameters were as follows: nebulizer gas, 3 L/min; drying gas, 10.0 L/min; interface, -4.5 kV; CID gas, 230 kPa; DL temperature and heat block temperature were maintained at 250 and 400 C, respectively. The quantification was carried out using multiple reaction monitoring modes (MRM). The m/z transitions were 335.8→320.0 (m/z) for Berberine, and 356.0→192.0 (m/z) for the internal standard (IS).

The peak areas of Berberine in fluid samples and the internal standard were recorded respectively. LC-MS/MS was also used for the analysis of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA. The m/z transitions were 810.5→303.5 (m/z) for acetyl-CoA, 851.6→345.2 (m/z) for acetoacetyl-CoA, 853.6→347.2 (m/z) for β-hydroxyl butyryl-CoA, 835.6→329.2 (m/z) for crotonyl-CoA, and 837.6→331.2 (m/z) for butyryl-CoA.
GC-2014 (Shimadzu Cooperation, Kyoto, Japan) was applied to analyze and quantify SCFAs. It was equipped with a flame ionization detector and an Alltech capillary column (AT-WAX, 30 m × 0.25 mm × 0.25 μm, Alltech company, ME, USA) operated in the splitless mode. The helium carrier flow was 37.0 cm/s under a column head pressure of 68.0 kPa. The oven temperature was initially 80 C for 1 min, which was gradually increased to 130 C at a rate of 5 C/min and maintained for 5 min. The injector and detector temperatures were set at 230 C and 250 C, respectively.

2.4. Berberine-mediated butyrate production in intestinal bacteria of the SD rats
A series of butyrate working solutions were prepared at concentrations of 1, 2, 10, 20, 200, and 500 μg/mL by diluting the stock solution (1 mg/mL) with purified water. Then, 50 μL of these solutions were further diluted with 50 μL of acetone. An aliquot of 1 μL of the solutions was injected into the GC-2014 for analysis and a standard curve of butyrate was subsequently created.

Colon contents from six SD rats were pooled, and 2 g of the mixture of colon contents was transferred into a flask containing 40 mL normal saline. After mixing thoroughly, the cultures were pre-incubated under anaerobic conditions with a N2 atmosphere at 37 C for 60 min. Berberine (10 μL) at different concentrations was added to the rat intestinal bacteria cultures (990 μL), with saline (10 μL) as a negative control. The final concentrations of Berberine in the incubation system were 10 and 20 g/mL, respectively. The cultures were incubated for 6, 12, and 24 h at 37

C. At the same time, an equal amount of intestinal bacteria was inactivated through boiling. After termination of the reaction with acetonitrile (1 mL), the incubation was mixed for 30 s and centrifuged at 14,800 rpm for 10 min. The supernatant (100 μL) was transferred into an Eppendorf tube with 100 μL of acetone and centrifuged at 10,000 rpm for 5 min after mixing thoroughly. An aliquot of 1 μL supernatant was injected into the GC-2014 for butyrate analysis.

2.5. Butyrate production by Berberine in intestinal bacteria strains in vitro
Eight intestinal facultative anaerobes were incubated under anaerobic conditions with Berberine at a final concentration of 10 μg/mL for 24 h, including Enterococcus faecium (E. faecium) ATCC 35667, Enterococcus faecalis (E. faecalis) ATCC 29212, Escherichia coli (E. coli) ATCC 25922, Bifidobacterium longum (B. longum) ATCC 15707, Bifidobacterium breve (B. breve) ATCC 15700, Lactobacillus acidophilus (L. acidophilus) ATCC 4356, Lactobacillus casei (L. casei) ATCC 334, and Clostridium butyricum (C. butyricum) ATCC 19398 from Guangdong Huankai Microbial Sci,. & Tech. Co., Ltd. (Guangdong, China). The sample processing procedures were identical to those previously mentioned. Butyrate was quantitatively analyzed using a GC-2014.

2.6. Hamsters with a high-fat diet
A high-fat diet (HFD) was used to induce hyperlipidemia in hamsters in an SPF-grade room. The HFD was made of 1.0% cholesterol, 1.0% sodium cholate, 10.0% lard, 5.0% yolk powder, and 0.2% propylthiouracil added to the standard forage. All of the healthy hamsters were fasted overnight before the experiment.

Based on their weights and their serum TC levels, the 42 hamsters were divided into two groups. The first group was a control group (8 hamsters) and the second was the HFD group (34 hamsters). The control group was given a standard diet. Both groups were free to drink water ad libitum. During the modeling period, the hamsters were weighed and their plasma TC, TG, and LDL-C values were determined every 2 weeks.

After 6 weeks, the hamsters were fasted for 12 h before blood samples were taken from the orbital venous plexus. Blood TC, TG, and LDL-C were detected using commercial kits. The hamster hyperlipidemia model was established when blood TC, TG, and LDL-C of the HFD hamsters were significantly higher than that of the control hamsters.

Eight healthy and 34 HFD hamsters were divided into 3 groups: 8 healthy hamsters as the control group (Group 1), 8 HFD hamsters as the HFD control group (Group 2), and 26 HFD hamsters treated with Berberine (100 mg/kg/day) as the treatment group (Group 3). Berberine was given orally once a day for 10 days.

On days 3, 5, 7, and 10 post-treatment, fresh feces was collected and blood was taken from the orbital venous plexus for plasma samples. The samples were stored at -80 C before analysis. The fecal solution was prepared by reconstituting feces in saline (1 g:3 mL), followed by centrifugation at 10,000 rpm for 5 min. Then, 50 μL of acetone was added to 50 μL of the plasma or the fecal solution, mixed thoroughly, and centrifuged at 10,000 rpm for 5 min. An aliquot of 1 μL of the supernatant was injected into the GC-2014 for butyrate (or propionate) analysis.

Blood TC, TG, and LDL-C were detected using commercial kits.
At day 10 after Berberine treatment (100 mg/kg/day, oral), the HFD hamsters were killed, and liver samples were taken and stored at -80 C. After thawing, the liver samples were homogenized with saline in a ratio of 1:2 [weight (g): volume (mL)]. Then, 100 μL of acetone was added to 100 μL of the liver homogenate, mixed thoroughly, and centrifuged at 10,000 rpm for 5 min. An aliquot of 1 μL of the supernatant was injected into the GC-2014 for butyrate analysis.

2.7. Ob/ob mice model
Eighteen ob/ob mice were randomly divided into 3 groups: 6 mice were given a low dose of butyrate treatment (200 mg/kg/d, Group 1), 6 were given a high dose of butyrate (400 mg/kg/d, Group 2), and 6 were given the Berberine treatment (100 mg/kg/d, Group 3). The drugs were administered orally and once a day for 10 days. The levels of TC, TG, and FBG in the ob/ob mice were tested before the experiment. On days 3, 7, and 10 post-treatment, feces and blood samples were taken for butyrate analysis, as well as TC, TG, and FBG detection, using the methods described above.
The ob/ob mice were also used for the Berberine intraperitoneal (ip) injection experiment, in which 12 mice were tested for blood glucose and lipid levels before the experiment. The 12 mice were then grouped, with 6 mice orally treated with Berberine (100 mg/kg/day, Group 1) and the other 6 mice ip treated with Berberine (20 mg/kg/day, Group 2). Berberine was given once a day for 10 days. Butyrate, TC, TG, and FBG were measured in the feces and plasma.

 

2.8. Pseudo-germ-free ob/ob mice model
The plasma glucose and lipid levels of ob/ob mice were tested before the experiment. Then, the 32 ob/ob mice were divided into four groups: 8 were untreated (Group 1), 8 were orally administered Berberine (100 mg/kg/day, Group 2), 8 were orally administered antibiotics only (Group 3), and 8 were orally administered both antibiotics and Berberine (100 mg/kg/day, Group 4). The regimen for antibiotics included cefadroxil (100 mg/kg/day), terramycin (300 mg/kg/day), and erythromycin (300 mg/kg/day).

For the treatment protocol, the ob/ob mice in Group 3 and 4 were orally administered antibiotics twice a day for 3 days to achieve pseudo-germ-free (PGF) status. Then, Berberine was given to the mice in Group 2 and 4 once a day for 10 days; simultaneously, antibiotics were continuously given to the mice in Group 3 and 4.
On days 3, 7 and 10 post-treatment, feces were collected for butyrate analysis as described, and blood samples were taken on day 10 to determine the levels of TC, TG, and FBG.

The colon contents of all ob/ob mice were collected on day 10 post-treatment, and the PGF status was confirmed by culturing the fecal samples anaerobically in a nutrient agar culture medium.

2.9. Influence on LDLR and InsR gene expression in human hepatocytes by butyrate
The HL-7702 cells were obtained from the Institute of Biochemistry and Cell Biology (SIBS, Chinese Academy of Science, Shanghai, China). Cells were cultured in RPMI-1640 medium with 10% FBS, 1% nonessential amino acids, and appropriate antibiotics in an atmosphere of 5% CO2 at 37 C. Cells were trypsinized and grown to about 70–80% confluence, then were starved in 0.5% FBS-containing medium for 24 h before the experiment.

Butyrate was dissolved in sterile saline, and Berberine was reconstituted in DMSO. They were then used to treat the cells for 24 h in 0.5% FBS-containing medium, as indicated. After treatment, total cellular RNA was isolated and reversely transcribed into cDNA by a commercially available kit according to the supplier’s protocol (Promega, CA, USA). Quantitative real-time PCR was performed with gene-specific primers, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control.

 

The sequences of the primers are LDLR upstream, aggacggctacagctaccc, LDLR downstream, ctccaggcagatgttcacg; InsR upstream, gctggattattgcctcaaagg, InsR downstream, tgagaatcttcagactcgaatgg; GAPDH upstream, tccactggcgtcttcacc, GAPDH downstream, ggcagagatgatgaccctttt. The reactions were performed in an ABI Prism 7900 High-Throughput Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), as previously described [23]. The comparative threshold cycle (CT) method was used for relative quantification of target gene expression, which was plotted as the fold change of the control.

2.10. Detection of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA
LC-MS/MS was used for the analysis of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA in the SD intestinal bacteria samples treated with Berberine. The optimized m/z transitions from the mass spectrum were 810.5→303.5 (m/z) for acetyl-CoA, 851.6→345.2 (m/z) for acetoacetyl-CoA, 853.6→347.2 (m/z) for β-hydroxyl butyryl-CoA, 835.6→329.2 (m/z) for crotonyl-CoA, and 837.6→331.2 (m/z) for butyryl-CoA. The fold of control, where the control was normalized as 1, was used to express the change of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, and crotonyl-CoA after Berberine treatment.

The external standard method was adopted for the determination of butyryl-CoA. The stock solution of butyryl-CoA (100 ng/mL) was prepared and stored at 4 C. The working solution was prepared at a series of concentrations of 1, 2, 10, 20, and 50 ng/mL by diluting the stock solution with purified water, from which the standard curve was obtained (r2 > 0.99).
Berberine (at final concentrations of 10 and 20 μg/mL) was incubated with SD intestinal bacteria for 6 or 12 h. Acetonitrile was added to terminate the reactions; the samples were centrifuged at 14,800 rpm for 10 min to obtain the supernatant, which was then dried under a nitrogen flow at room 20-22 C. The residue was dissolved in 100 μL of water and centrifuged at 10,000 rpm for 10 min. Then, the samples were analyzed using the LC-MS/MS 8050.

2.11. ATP, AMP, and NADH/NAD+ ratios in intestinal bacteria
SD intestinal bacteria samples were incubated with Berberine (at final concentrations of 10 and 20 μg/mL) for 6 and 12 h in an anaerobic condition. The treatment was terminated by direct centrifugation at 14,800 rpm for 10 min. Then, the supernatant was stored at 4 C, followed by detection of ATP, AMP, and the ratio of NADH/NAD+. The tests were carried out according to the manufacturer’s instructions in the kits.

2.12. Gene expression of butyrate kinase and butyryl-CoA:acetate-CoA transferase
A quantitative real-time RT-PCR assay method was used to measure the gene expression of butyrate kinase (BUK) and butyryl-CoA:acetate-CoA transferase (BUT). Total RNA was extracted using TRIzol Plus RNA Purification Kit (Invitrogen, CA, USA). A quantitative real-time RT-PCR analysis was performed using the Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems, CA, USA) in an ABI 7500 Fast System.

Briefly, 50 ng of total bacterial RNA was quantified in a 20 μL reaction mixture of the kit. The reaction was carried out with an initial holding (30 min at 48 °C), an initial denaturation (10 min at 95 °C), then 40 cycles of denaturation (15 s at 95 °C), and annealing/elongation (1 min at 50 °C for BUK; 1 min at 45 °C for BUT).

2.13. Bacterial composition analysis
The 16S rRNA genes were amplified using the specific primer of 16S V3-V4: 340F-805R to target the V3-V4 regions of 16S rRNA. PCR products were mixed in equidensity ratios. Then, a mixture of PCR products was purified with a GeneJET Gel Extraction Kit (QIAGEN, Germany). Sequencing libraries were generated by using a NEXTflex Rapid Illumina DNA-seq Kit from New England Biolabs (Ipswich, MA, USA) following manufacturer’s recommendations and adding index codes. The library quality was assessed on a Qubit 2.0 Fluorometer (Thermo Scientific, Carlsbad, CA, USA) and Agilent Bioanalyzer 2100 system (Agilent Technologies, USA).

Finally, the library was sequenced on a HiSeq2500 (Illumina) platform and 250 bp paired-end reads were generated. Sequences were analyzed using the Quantitative Insights Into Microbial Ecology (QIIME) software package. First, the QIIME quality filters categorized the reads. Then, we picked a representative sequence for each operational taxonomic unit (OTU) and used the ribosomal database project classifier to annotate taxonomic information for each representative sequence. Sequences with ≥97% similarity were assigned to the same OTUs.

2.14. Data analysis
Statistical analyses were conducted using a two-way ANOVA and Student’s t-test with GraphPad Prism Version 5 (GraphPad Software, La Jolla, CA, USA). The data are expressed as means ± standard deviation. P values less than 0.05 were considered statistically significant.

3. Results
3.1. Berberine treatment increased butyrate production in intestinal bacteria
SD rat intestinal bacteria (as feces) were collected for an in vitro anaerobic incubation in the presence or absence of Berberine. As shown in Fig. 2A, treating intestinal bacteria with Berberine caused an increased production of butyrate in a dose-dependent manner. The earliest significant increase of butyrate was seen 6 h after Berberine treatment (20 μg/mL) and the elevation remained stable for at least another 18 h (Fig. 2A).

 

Heat inactivation of the bacteria abolished the effect of Berberine (Fig. 2A, insert), indicating that the bacteria produced butyrate. Then, eight standard strains of intestinal bacteria were individually treated with Berberine under anaerobic conditions to validate its effect on butyrate.

 

As shown in Fig. 2B, six out of the eight strains increased their butyrate production after Berberine treatment for 24 h (10 μg/mL, *P < 0.05 or **P < 0.01), with the highest increase seen in L. acidophilus ATCC 4356 and the lowest in E. coli ATCC 25922.

Further, we carried out the investigation in hamsters. Feeding healthy hamsters a HFD for 6 weeks significantly decreased the butyrate level in their feces and plasma by 24% and 44%, respectively (Fig. 2C); and at the same time, TC, TG, and LDL-C increased in the hamsters (***P < 0.001 for all three; Fig. 2C).

Treating the HFD-hamsters with Berberine (orally, 100 mg/kg/d) for 10 days increased butyrate in their feces and plasma by 1.8- and 2.5-fold (Fig. 2D), respectively, verifying the butyrate-increasing effect of Berberine in vivo. Accordingly, TC, TG, and LDL-C significantly decreased in HFD-hamsters, as compared to that before treatment (Fig. 2D; ***P < 0.001 for all three).
3.2. Increasing butyrate production in the gut microbiota is a newly discovered mechanism of Berberine in reducing blood lipid and glucose levels

To elucidate the role of butyrate, obese ob/ob mice were treated directly with an oral administration of butyrate (sodium), using Berberine as a reference. As shown in Fig. 3A & B, butyrate increased in the feces and blood in a time- and dose-dependent manner, indicating an efficient absorption and excellent bioavailability in vivo. Berberine treatment revealed a positive effect on butyrate production similar to that observed in the HFD-hamsters (Fig. 2C & D). In an inverse correlation with the level of blood butyrate, blood TC, TG, and FBG went down in the ob/ob mice treated with butyrate (Fig. 3C, D, & E). This reduction positively correlated with the dosage of butyrate and the treatment time (Fig. 3C, D, & E), demonstrating the regulatory effect of butyrate on the metabolism of lipids and glucose.

Although the plasma butyrate level in the Berberine-treated ob/ob mice was lower than that in the mice directly treated with butyrate (Fig. 3B, *P < 0.05, day 7 and 10), the lipids and glucose-lowering efficacy of Berberine was, in general, higher than that of direct butyrate treatment (Fig. 3C, **P < 0.01 on day 10; Fig. 3E, **P < 0.01 on day 7 and 10). The results indicate that the butyrate mechanism played a role in lowering blood lipid and glucose levels, in addition to the direct action of the circulated Berberine.

To elucidate the direct effect of Berberine in a bacteria-free condition, we treated the ob/ob mice with ip Berberine. Berberine at 20 mg/kg/d was used for ip injection for 10 days, considering that the oral bioavailability of Berberine was below 10% [31], and oral Berberine (100 mg/kg/d) served as a reference. As shown in Fig. 3F, ip administration of Berberine (20 mg/kg/d) to the mice for 10 days did not increase the level of butyrate in the feces (Fig. 3F) or blood (Fig. 3F), but significantly lowered blood TC, TG, and FBG with an efficacy similar to that of an oral Berberine treatment (100 mg/kg/d; Fig. 3G).

Interestingly, although an oral administration of Berberine (100 mg/kg/d, for 10 days) showed a blood concentration 56% of the ob/ob mice ip treated with Berberine (20 mg/kg/d, for 10 days; Fig. 3G, insert), its therapeutic efficacy was almost equal to that of the ip injection, probably because it caused a significant increase of butyrate in the blood (Fig. 3F; *P < 0.05 on day 7, ***P < 0.001 on day 10).

 

The results indicate that the overall lipid and glucose-lowering effects of orally administered Berberine represent a synergistic effect of at least two mechanisms. The first one correlates to the direct effect of circulated Berberine on cellular targets (such as LDLR, InsR, AMPK, and PCSK9), and the second relates to the Berberine that remains in the intestines and works through the gut microbiota metabolites, such as butyrate. As butyrate did not increase the expression of LDLR and InsR in hepatocytes (Fig. 3H), the two mechanisms appear to operate independently.

We found that body weights of the Berberine-treated ob/ob mice were significantly lower than those of the control mice on day 10 (**P < 0.01). In addition, the food intake of the Berberine-treated ob/ob mice slightly decreased but remained close to that of the control (Fig. S1). The results show an improvement in energy metabolism by Berberine.

3.3. Inhibition of the gut microbiota by antibiotics attenuated the effect of Berberine on butyrate
To further explore the significance of the gut microbiota from the Berberine treatment, antibiotics were used to create PGF ob/ob mice, based on previously described methods [30]. The ob/ob mice were orally pre-treated with antibiotics for 3 days (see Methods), followed by Berberine treatment with or without simultaneous administration of the antibiotics. The day 10 results are shown in Fig. 4.

Intestinal bacteria colony numbers in the PGF ob/ob mice treated with both Berberine and antibiotics were significantly lower than that of ob/ob mice treated with Berberine alone, with bacterial colony numbers reduced by 57% (0.4 logs; Fig. 4A).
Butyrate concentrations in the feces and plasma of the mice were examined.

 

As shown in Fig. 4B, on day 10, the level of butyrate in either feces or the blood of the Berberine-treated mice reduced by more than 30% as a result of antibiotic administration. With respect to the therapeutic efficacy of Berberine on conventional ob/ob mice (with no antibiotics), treating ob/ob mice orally with antibiotics before and during treatment largely decreased the therapeutic efficacy of Berberine on TC by 44% *(1− (100–82)/(100–68))× 100%+, TG by 41% *(1− (100–84)/(100–73))× 100%] and FBG by 46% *(1−(100–81)/(100–65))× 100%] (Fig. 4C, D, & E).

 

It seemed that an oral administration of antibiotics suppressed intestinal bacteria communities, and, accordingly, decreased butyrate production in the intestinal track, leading to a reduced therapeutic efficacy of Berberine on blood lipid and glucose levels. In addition, the antibiotic-induced reduction of Berberine absorption could also be a reason for the decline of the treatment effect [30].

 

Treating ob/ob mice with antibiotics alone for 10 days decreased TG and FBG to some degree in the mice, although the differences between the untreated control and antibiotic-treated group were not statistically significant; antibiotic treatment did not change TC in the ob/ob mice (Fig. 4C, D, & E).

3.4.Berberine upregulated butyrate synthesis and increased the abundance of the butyrate-producing bacteria
Butyrate is one of the main non-gaseous fermentation end products in anaerobic microbial communities. In this metabolic pathway, two molecules of acetyl-CoA are assembled to form acetoacetyl-CoA. After going through the intermediate steps of ß-hydroxybutyryl-CoA and crotonyl-CoA, the acetoacetyl-CoA is converted to
butyryl-CoA, which transforms to butyrate via the phosphotransbutyrylase 23
(PTB)/BUK pathway or the BUT pathway [15, 35]. In the present study, we found that an incubation of the gut microbiota with Berberine for 12 h largely decreased ATP production (***P < 0.001, for both low and high concentrations of Berberine). A significant early decline in ATP was found 6 h after Berberine treatment (20 μg/mL, **P < 0.01, Fig. 5A) as well. Paralleled with the ATP decline was an increase of AMP (Fig. 5A insert). The results were consistent with that of the Berberine found in the mitochondria of mammalian cells [27].

The reduction of ATP increased the expression of PTB/BUK and BUT [16] (Fig. 5B & C), both of which then expedited the transformation from butyryl-CoA to butyrate (Fig. 5D). The upregulatory effect on the expression of BUT and PTB/BUK were evidenced in the C. butyricum treated with Berberine (Fig. 5B insert & 5C insert). It should be mentioned here that as the PTB and BUK utilize one co-operator in transcription [35], the two enzymes were analyzed in the quantitative real time RT-PCR as one unit [34] (see Methods).

 

Although forming butanol is another metabolic direction of butyryl-CoA if the NADH level is high [16], we found butanol levels unchanged in Berberine treatment (Fig. 5E). In fact, Berberine reduced the level of NADH in the intestinal bacteria, with a decline of NADH/NAD+ ratio by 37.8% when Berberine was at 20 μg/mL (Fig. 5F, **P < 0.01). In addition, crotonyl-CoA and butyryl-CoA, the precursors of butyrate, were elevated, respectively, by Berberine (***P < 0.001, in 6 h), and the elevation continued to be significant for 12 h (**P < 0.01, Fig. 5G; Fig. 5H).

The increase of the two butyrate precursors might help the intestinal bacteria to uphold the production of butyrate in the Berberine treatment (Fig. 6A).
Besides the biochemical processes mediated by the bacterial enzymes mentioned above, the intestinal bacterial composition was analyzed. The ob/ob mice were treated orally with Berberine (100 mg/kg/day) for 10 days and their feces sample was taken for the bacterial composition analysis. The barcoded pyrosequencing of the V3 and V4 regions of the 16S rRNA gene showed that Berberine enriched the abundance of butyrate-producing bacteria in mice intestines. The heat-map of the top 50 bacterial genera that exhibited the most substantial change in abundance after exposure to Berberine is shown in Fig. 6B.

 

Of the 50 genera, the abundance of 9 genera increased after Berberine treatment. Seven of the nine genera were able to produce butyrate, including Enterobacter [36], Escherichia−Shigella [37], Incertae sedis [38], Lachnospiraceae FCS020 group [38], Akkermansia [39], Clostridium sensu stricto 1 [40], and Bacteroides [41], with the biggest increase seen in Enterobacter and Escherichia−Shigella (Fig. 6B). As Berberine showed only a minor inhibitory effect on intestinal bacteria in mice on day 10 post-treatment (Fig. 4A), the increased abundance of the butyrate-producing bacteria by Berberine represents a favorable action of the drug on these bacteria.

 

4. Discussion
The physiological role of the microbial-mammalian axis is becoming increasingly attractive. Metabolites from functioning intestinal microbiota, such as SCFAs and vitamins, are part of the organic chemical composition of human blood [42-44] and distributed throughout the organs, contributing to overall well-being [45].

 

The results presented in this study demonstrate that modulating gut microbiota production of butyrate by Berberine increase the level of butyrate in blood, as well as in liver (Fig. S2).
Butyrate is an important member of the SCFA family. The effect of SCFAs in tissues is mainly mediated through the function of its cellular receptors, free fatty acid receptor 2 (FFAR2) or free fatty acid receptor 3 (FFAR3), which are both G protein-coupled receptor (GPCR) proteins [46, 47] on the cell surface. FFAR3 linked with the pertussis toxin-sensitive Gi/o family participates in the SCFA-induced leptin production in adipose tissue, as well as lipid metabolism regulation. Whereas FFAR2 couples with either the Gi/o or pertussis toxin-insensitive Gq family and is involved in inflammation, glucagon-like peptide 1 (GLP-1) secretion, and body energy regulation [47-49].

In fact, Gao et al. showed that butyrate treatment could prevent obesity and insulin resistance, and the mechanism is related to promotion of energy expenditure and induction of mitochondrial function [50]. Clinical studies have shown that oral Berberine treatment increased insulin sensitivity and glucose disposal rates in patients with type 2 diabetes [18, 20].

Besides butyrate, Berberine treatment stimulated the gut microbiota to produce propionate as well (Fig. 1A), which entered the blood (Fig. S3) and showed bioactivities similar to that of butyrate [2]. The Berberine-induced metabolite profile of the gut microbiota is now under investigation in our laboratory. The functional metabolites from the gut microbiota could be considered drug messengers that enter the blood and exert the therapeutic effects of the original drugs that are poorly absorbed in the intestines, for instance, Berberine.

The increased abundance of butyrate-producing bacteria could be a reason for the elevation in butyrate production. One of the possible explanations is that Berberine might have a selective influence on some of the intestinal bacteria [33]; however, the detailed underlying mechanism remains unclear. As the elevated level of butyrate was verified in individual bacterial strains treated with Berberine in vitro, we were curious about the biochemical mechanism and found the PTB/BUK and BUT enzymes important in upregulating butyrate production.

Although bacterial PTB/BUK and BUT enzymes seemed to be involved in the mechanism, a gene knockout experiment was not performed in the present study. This is because it has been reported that PTB/BUK gene knockout mutants showed no decrease in butyrate production in C. tyrobutyricum [51], as butyrate is an end product of the energy metabolism network in bacteria (Fig. 6A). Therefore, the molecular mechanisms involved in Berberine-mediated increase of butyrate in bacteria need further investigation.

Although the presented work investigates the role of the gut microbiota in the mode of action of Berberine, the finding is of particular significance to herbal medicines, because herbal chemicals are often poorly absorbed in the intestines [52, 53].

Herbal derivatives such as glycosides, alkaloids, flavonoids, and polysaccharides have been investigated for decades and have been reported to be active for certain diseases in patients (or in animals) via oral administration [17, 54-56].

However, the intestinal absorption rates for many of the phytochemicals are very poor and their blood and organ concentrations are low [31, 57-59], raising questions on their therapeutic efficacy observed in patients. The phenomena could not be explained by the current theory of oral drug bioavailability, which was established fundamentally on the evaluation of drug absorption through the intestines [60].

The therapeutic effect of the functional metabolites from the gut microbiota could be a sound justification for the discrepancy. In addition, as the composition of the gut microbiota differs from patient to patient, the clinical efficacy of drugs might be different.

It suggests that the interaction between drug and the gut microbiota might be considered as part of the investigation on personalized medicine. In fact, genetic background, antimicrobials, diet, and physical exercise modulate the composition of intestinal bacteria [30, 61, 62] and, therefore, might influence the therapeutic efficacy of orally administered botanical chemicals poorly absorbed in the intestines.

In the view of drug discovery, orally administrated drugs, which are poorly absorbed and work through bacterial functional metabolites, might be attractive. First, these drugs might have a decreased chance of causing adverse effects in patients, as they hardly enter the blood circulation.

Second, drug stability in the blood, structural modification by hepatic CYP450, and tissue accumulation, which are often significant concerns for chemical drugs, do not seem to be critical for the drugs working through the gut microbiota.

Through anaerobic fermentation, intestinal microbiota could produce various metabolites that are of great potential in pharmacology, such as SCFAs [10, 43], making the gut microbiota a built-in factory synthesizing drug-like substances.

Discovering bioactive metabolites from the gut microbiota and understanding the control of their production in bacterial fermentation might open a new avenue in drug development.

L-Carnitine: Is it Effective for Weight Loss?

L-carnitine is a nutrient and weight-loss supplement.

Some evidence suggests that supplementing with L-carnitine may promote weight loss. However, studies have provided mixed and inconclusive results.

For this reason, a group of Iranian researchers combined the results of several L-carnitine trials in a meta-analysis.

Here is a summary of their findings.

Background

L-carnitine is a nutrient found in high amounts in meat.

It has essential functions in the body and is involved with fatty acid oxidation (fat burning) and glucose metabolism (12).

However, it is not essential to your diet, since your liver and kidneys can produce it from the amino acids lysine and methionine.

Yet, some researchers believe dietary carnitine intake to be important, and evidence suggests it may promote weight loss by increasing calorie expenditure (345).

Article Reviewed

This was a systematic review and meta-analysis of studies examining the effect of L-carnitine on weight loss.

The effect of (L-)carnitine on weight loss in adults: a systematic review and meta-analysis of randomized controlled trials.

Study Design

This was a systematic review and meta-analysis of randomized controlled trials testing the effects of L-carnitine on weight loss.

It was conducted according to the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guidelines (6).

Using electronic databases, the researchers searched for all relevant articles. Nine studies, which recruited a total of 911 participants, were selected based on quality criteria.

In all of the studies, the participants supplemented with L-carnitine for at least one month.

Bottom Line: This was a systematic review and meta-analysis of randomized controlled trials examining the effects of L-carnitine on weight loss.

The Selected Studies

Nine studies were selected based on pre-specified criteria. Below are summaries of some of the included studies.


Coelho Cd, et al. The supplementation of L-carnitine does not promote alterations in the resting metabolic rate and in the use of energetic substrates in physically active individualsArquivos Brasileiros de Endocrinologia e Metabologia, 2010.

11 physically-active Brazilians supplemented with 1.8 grams of L-carnitine per day for one month. Carnitine supplementation did not affect body composition or calorie intake, compared to a placebo.


Derosa G, et al. The effect of L-carnitine on plasma lipoprotein(a) levels in hypercholesterolemic patients with type 2 diabetes mellitus. Clinical Therapeutics, 2003.

46 diabetic patients supplemented with 2 grams of L-carnitine per day for 3 months. Supplementing with L-carnitine did not cause a greater decrease in body mass index (BMI), compared to a placebo.


Derosa G, et al. Comparison between orlistat plus l-carnitine and orlistat alone on inflammation parameters in obese diabetic patients. Fundamental and Clinical Pharmacology, 2011.

258 diabetic patients were randomly assigned to supplement with 120 mg of orlistat three times per day, or the same amount of orlistat plus 2 grams of L-carnitine once per day, for one year.

Those who supplemented with orlistat and L-carnitine lost significantly more weight, compared to those who only took orlistat.


Derosa G, et al. Effects of combination of sibutramine and L-carnitine compared with sibutramine monotherapy on inflammatory parameters in diabetic patients. Metabolism, 2011.

254 diabetic patients were randomly assigned to receive either 10 mg of sibutramineplus 2 grams of carnitine, or sibutramine alone, every day for one year. Supplementing with L-carnitine led to significantly greater weight loss.


Elmslie JL, et al. Carnitine does not improve weight loss outcomes in valproate-treated bipolar patients consuming an energy-restricted, low-fat diet. Bipolar Disorders, 2006.

30 patients with bipolar disorder supplemented with 6.8 mg of L-carnitine per pound (15 mg per kilogram) of body weight daily for 26 weeks while following a moderately calorie-reduced diet.

Supplementing with L-carnitine did not significantly affect weight loss, compared to a placebo.


Pistone G, et al. Levocarnitine administration in elderly subjects with rapid muscle fatigue: effect on body composition, lipid profile and fatigue. Drugs & Aging, 2003.

42 healthy older people supplemented with 4 grams of L-carnitine every day for one month while following an exercise program.

Those who supplemented with L-carnitine lost significantly more fat mass and gained greater muscle mass, compared to a placebo.


Rafraf M, et al. Effect of L-carnitine supplementation in comparison with moderate aerobic training on serum inflammatory parameters in healthy obese women. The Journal of Sports Medicine and Physical Fitness, 2015.

22 obese women from Iran supplemented with 2 grams of L-carnitine per day for two months. Half of them followed an aerobic training program.

Supplementing with L-carnitine alone, or in combination with aerobic training, did not significantly affect body weight.


Villani RG, et al. L-Carnitine supplementation combined with aerobic training does not promote weight loss in moderately obese women. International Journal of Sport Nutrition and Exercise Metabolism, 2000.

18 overweight Australian women supplemented with 4 grams of L-carnitine for two months. They also walked for 30 minutes four days per week. Supplementing with L-carnitine did not affect total body mass or fat mass.


Finding: L-Carnitine May Cause Weight Loss

Supplementing with L-carnitine led to a 1.33 kg greater weight loss, on average, compared to a placebo.

L-carnitine supplementation led to significant weight loss in diabetic and non-diabetic individuals, as well as obese and normal-weight people.

Additionally, the analysis indicated that the weight loss effects of L-carnitine are strongest in the beginning but decrease over time.

However, the relevance of these findings is unclear because the included studies varied widely in their design.

Bottom Line: This meta-analysis concluded that supplementing with L-carnitine may cause slight weight loss.

Limitations

The main limitation of this meta-analysis was its study selection.

The included studies differed in their methods and not all were weight-loss trials. This makes interpreting the findings difficult.

The meta-analysis itself didn’t appear to have any methodological limitations, but the paper lacked detail, clarity and contained some incorrect references.

Summary and Real-Life Application

In short, this meta-analysis of randomized controlled trials suggests that supplementing with L-carnitine for more than a month may promote modest weight loss.

However, the evidence is inconclusive and limited overall. More high-quality studies are needed.

The Many benefits of Gingko Biloba

Ginkgo biloba - Dr. Axe

Ginkgo biloba, which is also known as maidenhair, is an ancient plant extract that has been used in China medicinally to heal various health ailments for thousands of years. In fact, the University of Maryland Medical Center reports that ginkgo biloba is the oldest tree species on earth, and today it is one of the top-selling herbal treatments worldwide.

Ginkgo’s been widely studied for its effective anti-inflammatoryantioxidant, platelet-forming and circulation-boosting effects. According to current research, ginkgo biloba benefits include improved cognitive function, positive mood, increased energy, improved memory and reduced symptoms related to multiple chronic diseases — for instance, it’s been used as an asthma natural remedyADHD natural remedy and dementia treatment. In fact, it’s believed to be so effective that it’s even a prescription herb in Germany!


What Is Ginkgo Biloba?

Ginkgo biloba (which goes by the scientific name Salisburia adiantifolia) is a natural extract derived from the leaf of the Chinese ginkgo tree, also called the maidenhair tree. EGb761 and GBE are the scientific terms for standardized extract of the green ginkgo biloba plant, which is often noted for its cerebral-enhancing effects.

Ginkgo has been studied for decades in France, Germany and China. And although Chinese herbal medicine has used both the dried ginkgo leaf and seed for thousands of years, today the focus in clinical studies is on the effectiveness of standardized ginkgo biloba liquid extract made from the plant’s dried green leaves.

According to Traditional Chinese Medicine and current clinical studies, ginkgo biloba is safe, effective and benefits the body in numerous ways because it exerts protective effects against mitochondrial damage and oxidative stress. It’s been used in Chinese herbal medicine to treat a variety of medical conditions since ancient times, especially circulatory problems and those related to declining memory.

What makes ginkgo so powerful? Ginkgo biloba extract contains two constituents (flavonoids and terpenoids) that have strong antioxidant properties. It’s believed these may help slow down the progression of age-related diseases by combating oxidative stress that usually worsens as someone ages.

While people of all ages seem to benefit from taking ginkgo for various reasons, some results suggest that its cognitive-enhancing effects are more likely to be apparent in individuals aged 50–59 years. According to the University of Maryland,

Scientists have found more than 40 components in ginkgo. But only two are believed to act as medicine: flavonoids and terpenoids. Flavonoids are plant-based antioxidants. Laboratory and animal studies show that flavonoids protect the nerves, heart muscle, blood vessels, and retina from damage. Terpenoids (such as ginkgolides) improve blood flow by dilating blood vessels and reducing the stickiness of platelets.

For people of all ages, its ability to increase vascular dilation and improve health of blood vessels means it supports brain activity, development, detoxifying mechanisms and immune function. Many of ginkgo’s most prominent benefits are tied to brain function like focus and memory as well as mental performance. In fact, according to a report in the International Journal of Phyotherapy and Phytopharmacology, ginkgo biloba is “currently the most investigated and adopted herbal remedy for cognitive disorders and Alzheimer’s disease (AD).”

One theory is that because it can help increase uptake of glucose (broken down sugar) by brain cells, it has the potential to improve the transmission of nerve signals responsible for memory, mood, task completion, heartbeat regulation and eye health — in addition to many other vital functions.


11 Proven Ginkgo Biloba Benefits

1. Increases Concentration

Research shows that ginkgo can help combat poor concentration, reverse cognitive decline and and heal fatigue. It’s even useful for helping to treat cerebral insufficiency — a condition characterized by chronically low concentration, confusion, decreased physical performance, fatigue, headaches and mood changes.

Many of the brain-boosting ginkgo biloba benefits that researchers have discovered rest on the fact that it’s an effective anti-inflammatory that increases antioxidant activity, lowers oxidative stress and improves circulation — all important factors for maintaining cognitive health.

When researchers from the Institute for Medical Psychology at the University of Munich tested the effects of ginkgo on healthy adults’ mental performance over a four-week period, they found significant differences in self-estimated mental health as well as self-estimated quality of life between those taking ginkgo and the placebo group. This is true even though there were no existing differences between the two groups in terms of general health.

The group taking ginkgo experienced better motor performance and emotional health, and reported no known drug-induced side effects or intolerance. No serious adverse events were observed during the study overall, which suggests that ginkgo is a safe and effective way to boost mental capabilities with little risk.

2. Reduces Risk for Dementia and Alzheimer’s

While not a total cure, overall scientific literature suggests that ginkgo biloba benefits people experiencing cognitive decline, including those with dementia of Alzheimer’s disease (AD). Certain studies have found ginkgo can help improve cognitive performance and memory in both older and younger adults but might be especially useful for age-related mental decline.

Most studies have investigated the effects of ginkgo on lowering Alzheimer’s symptoms in patients already undergoing standard AD treatment with cholinesterase inhibitor drugs (ChEIs). But when groups of AD patients taking additional ginkgo supplementation have been compared to those not taking ginkgo-combination therapy over at least a one-year period, significant differences in quality of life have been reported, according to scores on the Alzheimer’s Disease Assessment Scale (ADAS-Cog) and Activities of Daily Living (ADL) Scale.

Ginkgo might be able to help people recover from strokes or traumatic brain injuries, too. In extract form, it’s widely used in the treatment of acute ischemic stroke in China. When researchers from Beijing University of Chinese Medicine reviewed evidence from 14 randomized controlled trials involving brain injury patients, they found mixed results but reported that ginkgo biloba extract had positive effects on patients’ neurological impairment and quality of life in nine of the trials.

Some studies have even found that in combination with antipsychotic drugs, ginkgo might be an effective supplemental treatment for people with schizophrenia and serious mental disorders. It also has the potential to improve cognitive function in people with multiple sclerosis (MS) — making it a potential natural treatment for multiple sclerosis— although more formal studies are still needed.

3. Helps Fight Anxiety and Depression

If you suffer from chronically high stress that’s killing your quality of life, nervousness, depression or mood swings, ginkgo might be able to help. Research suggests ginkgo biloba benefits the body’s ability to handle stressors and counteracts the effects of high levels of stress hormones, like cortisol and adrenaline.

Known as an adapotgen herb that naturally raises the body’s ability to cope with trouble and worry, it might be especially helpful for people with generalized anxiety disorder (GAD) and possibly seasonal depression, panic attacks and social phobias, too.

4. Fights Symptoms of PMS

Some early research has shown positive effects of taking ginkgo on reducing PMS symptoms, including mood swings, headaches, anxiety, fatigue and muscle pain. It also appears to have beneficial effects on mood and cognition in postmenopausal women and can help improve similar symptoms.

One 2008 study published in the Journal of Alternative and Complimentary Medicinecompared the effects on ginkgo biloba in two groups of women that were similar in terms of demographic characteristics and baseline overall severity of PMS symptoms. After a six-month intervention with ginkgo, there was a significant decrease in the overall severity of physical and psychological symptoms in both the group taking 40 milligrams daily of ginkgo extract and the placebo group; however, a higher percentage of the ginkgo group (23.7 percent) had improvements compared to the placebo (8.7 percent).

5. Helps Maintain Vision and Eye Health

While more evidence is still needed, ginkgo appears to be beneficial for eye health since it improves blood flow to the eyes and fights free radial damage that can harm the cornea, macula and retina. It might be especially beneficial for older adults in preserving vision and lowering UV damage or oxidative stress to eye tissue.

Some studies have found ginkgo to be effective at lowering the risk for age-related macular degeneration thanks to its platelet-activating factors and prevention of membrane damage caused by free radicals. Vascular factors and oxidative damage are thought to be two primary causes of vision loss and other age‐related eye disorders, but antioxidant plants and herbs like ginkgo help mitigate these effects.

 

Ginkgo benefits infographic - Dr. Axe

 

6. Helps Prevent or Treat ADHD

Certain studies using combination therapies that include ginkgo have found relief and improved concentration for people with ADHD symptoms. And because it can improve concentration, memory and task performance, it can possibly also reduce symptoms in people with dyslexia.

While more research is still needed, there’s also some early evidence that ginkgo can help reduce behaviors and symptoms of autism, making it a potential autism natural treatment.

7. Improves Libido

It’s believed ginkgo has positive effects on hormonal balance — especially serotonin levels, blood pressure and circulation — therefore it might help some people struggling with erectile dysfunction and low libido. Ginkgo has the potential to dilate blood vessels and improve blood flow to the genitals, which is important for reproductive health.

Some reports show it’s potentially effective in treating antidepressant-induced sexual dysfunction predominately caused by selective serotonin reuptake inhibitors.

8. Helps Treat Headaches and Migraines

Ginkgo might be an effective way to naturally remedy frequent headaches and reduce the rate and severity of migraines since it reduces pain, increases blood vessel dilation and combats stress that can all trigger an attack. Headaches can be triggered by stress, fatigue, allergies, eyestrain, poor posture, alcohol or drugs, low blood sugar, hormones, constipation, and nutritional deficiencies. The amazing benefits that ginkgo has on our stress and fatigue goes hand in hand with its ability to lessen headache tension.

9. Lowers Symptoms of Asthma

Some studies have found ginkgo extract can reduce asthma-related symptoms. Because it lowers inflammation, improves antioxidant activity and has positive effects on nerve functioning, people have reported less trouble breathing when taking ginkgo.

10. Helps Heal Hemorrhoids

Certain studies have found that ginkgo biloba benefits people experiencing painful hemorrhoids, which cause swelling, pain and bleeding because of an increase in pressure on the veins of the anus and rectum. Ginkgo can help lower pain, improve pain tolerance and decease inflammation, which helps to stop bleeding associated with hemorrhoids, making ginkgo biloba an effective hemorrhoids treatment.

11. Fights Fibromyalgia

Some studies have found that supplementing with CoQ10 and ginkgo together improved quality of life for people diagnosed with fibromyalgia, a disorder of the nervous system. Fibromyalgia is a widespread muscle pain typically accompanied by fatigue; headaches; and difficulty with sleep, anxiety and depression. Ginkgo biloba can be used as a natural fibromyalgia treatment.


Recommended Dosage of Ginkgo Biloba

Effects of ginkgo biloba seem to be dose dependent, so the more you take the bigger results you may see — although you still should carefully stick to recommended values. Depending on the condition, doses can range from 40 to 300 milligrams daily. Some people have reported results in lowering pain and nervousness while taking lower doses around 40 milligrams daily, while other studies have found better cognitive improvements at around 120 milligrams daily. Higher levels are likely needed for older adults and those who have existing hormonal imbalances, inflammation-related symptoms, cognitive impairments and mood disorders.

You can find ginkgo in capsule, tablet, liquid extract or dried leaf form in most health food stores and also online. Look for it in standardized extract form containing 24 percent to 32 percent flavonoids (also known as flavone glycosides or heterosides) and 6 percent to 12 percent terpenoids (triterpene lactones).

Below are the recommended dosages depending on your specific health condition:

  • Memory problems and Alzheimer’s disease: 120–240 milligrams daily in divided doses, standardized to contain 24 percent to 32 percent flavone glycosides (flavonoids or heterosides) and 6 percent to 12 percent triterpene lactones (terpenoids).
  • Low concentration or fatigue (such as for ADHD, depression, mood changes): 120–240 milligrams per day.
  • Inflammatory diseases and those requiring improved blood flow (asthma, PMS, aches or pains, fatigue, fibromyalgia): 120–240 milligrams per day.
  • As of now, researchers feel ginkgo should not be given to children.

How quickly can you expect to see improvements? It can take between four to six weeks to see any effects from ginkgo, so be patient. While it’s possible to feel positive effects sooner, people may need time to experience the inflammation-reducing effects.


Concerns and Interactions of Ginkgo Biloba

Even though ginkgo is considered very safe and unlikely to cause any side effects, as with all herbal treatments there are some precautions you’ll want to take. Some rare cases have reported bleeding in a very small percentage of patients taking ginkgo biloba, so it’s possible that the extract can interact with anticoagulants and antiplatelet agents. It also might interfere with recovery from surgery or serious injuries

As an increasing variety of alternative health care products become available, known to many people as “over-the-counter” treatments, many people choose to take these (sometimes in combination with other herbs) but don’t discuss the herbs with their doctors even when necessary. Some reports show that up to 70 percent of patients might not mention herbal therapy use to their doctors during visits, even when they suffer from existing health conditions or are preparing for surgery.

It’s always a good idea to stick to recommended dosages of any herbs and also mention them to your doctor if you’re taking other prescriptions, preparing for surgery or battling any chronic disorders — this way dangerous interactions don’t potentially occur.

What is NAD+ effect on disease and aging

Dr. David Sinclair, Co-Director of the  Biological Mechanisms of Aging at Harvard Medical School was named to  the Times Magazine list of “Most Influential People in the World” after his research found a key cause of aging  and a potential weapon to reverse it.

He and his team found that as we age, our cells become less and less efficient due to the lack of an essential metabolite called Nicotinamide Adenine Dinucleotide (NAD+).

WHAT IS NAD+

NAD+ is a key co-enzyme that the mitochondria in every cell of our bodies depend on to fuel all basic functions. (3,4)

NAD+ play a key role in communicating between our cells nucleus and the Mitochondria that power all activity in our cells (5,6,7,8)

Low NAD+ levels impair mitochondria function and are implicated in  health problems such as cancer, diabetes, heart disease, immune problems, and  perhaps even aging itself (5,6,7,9,10,11,13,14,15,16).

 

 

 

NAD+ LEVELS DECREASE WITH AGE

NAD+ levels decreaseAs we age, our bodies produce less NAD+ and the communication between the Mitochondria and cell nucleus is impaired. (5,8,10).

Over time,  decreasing NAD+ impairs the cell’s ability to make energy, which leads to aging and disease (8, 5) and perhaps even the key factor in why we age (5).

 

 

“NAD+ levels drop by as much as 50% as we get older”

 

 

CAN INCREASED NAD+ REVERSE AGING?

There is reason to think that increased  NAD+ can at least slow the aging process.

When taken orally, NAD+  does not survive the digestive system long enough to enter your cells (14)

The ground-breaking paper published by Dr Sinclair found that supplementation with Nicotinamide MonoNucleotide (NMN), the immediate precursor to NAD+,  could boosts NAD+ levels in mice and resulted in the “equivalent of a human 60 year old becoming more like a 20 year old”(8).

More importantly, their research revealed that mitochondrial dysfunction is reversible with supplementation to boost NAD+

The 2013 study by Dr Sinclair at Harvard is explained in this video below:

HOW TO INCREASE NAD+

There are a number of lifestyle changes you can make  to increase NAD+ in you body.

It’s well known that Calorie Restriction  (CR) can extend longevity by 30–50% in many mammals (32)

CR has also been shown to increase NAD+ levels in the body , thru these pathways:

  • Lowering blood glucose levels minimizes inflammation, which consumes NAD+.
  • The ketone body BHB signals to increase AMPK to produce more NAD+
  • Burning Ketones for fuel instead of glucose requires 1/2 as much NAD+

– Ketone bodies mimic the life span extending properties of caloric restriction (veech,2017)

 KETOSIS BOOSTS NAD+

Ketosis is a metabolic state in which fat provides most of the fuel for the body. It occurs when there is limited access to glucose (blood sugar), which is the preferred fuel source for many cells in the body.

Ketosis can occur in many different diet plans whenever carb intake is low, but is most often associated the Ketogenic Diet, as that is a much easier method for restricting carbs (3, 4, 5, 6).

Recent research now shows  Ketosis  provides the benefit in life extension, lowering inflammation and boosting NAD+ (3,9).

Intermittent or Periodic Ketosis is also effective at extending lifespan and likely achieves much of the benefit (36,37).

Some research even shows more benefit from a cyclical rather than a full time Ketogenic Diet (71).

Ketogenic Diet Reduces Midlife Mortality and Improves Memory in Aging Mice (Newman, 2017)

The Red bars in the chart at left show the increased levels of the Ketone Body BHB produced from a cyclical Keto diet, resulting in Increased NAD+ and greatly improved neurological function and health.

Read more about nutrition for boosting NAD+

EXERCISE THAT BOOSTS NAD+


Researchers are finding that 2-3  short bouts of High Intensity Interval Training  (HIIT) per week is far more effective at lowering inflammation (and increasing NAD+), especially among older adults (55)

Exercise is very effective at boosting AMPK and NAD+, especially when performed at times of low blood glucose levels  ( more about HIIT ).

Short bouts of HIIT accomplishes the goal, while avoiding overtraining from endurance workouts  which increases inflammation and consumes NAD+ (55).

Read more about exercise for boosting NAD+

SUPPLEMENTATION TO  BOOST NAD+

In mammals, NAD+ can be created from simple elements present in the body such as Nicotinic Acid or Tryptophan thru the “de novo” pathway.

However the entire NAD+ pool is consumed 2-4 times a day and recycled thru the “salvage pathway”, which is far more important for maintaining NAD+ levels (14).

In the salvage pathway, Nicotinamide or Nicotinamide Riboside are first converted to NMN, which is then further converted to NAD+(14).

NMN is more correctly referred to as a NAD+ intermediate because NMN is the last step before conversion to NAD+

NAD+ Precursors:

  • Tryptophan
  • NA – Nicotinic Acid
  • NAM – Nicotinamide
  • NR – Nicotinamide Riboside
  • NMN – Nicotinamide Mononucleotide

The first 3 NAD+ precursors are well known and have been used for decades to treat various metabolic diseases such as dislipidemia and neurological conditions (10,11,14)

NR was discovered by Dr Charles Brenner. Like NMN, NR is being tested in mice and humans for a wide range of disease and illness.

According to Dr Brenner:
“Not every cell is capable of converting each NAD+ precursor to NAD+ at all times…the precursors are differentially utilized in the gut, brain, blood, and organs” (R).

NMN ENTERS THE BLOOD STREAM IN MINUTES

mouse-single-dose

In this 2016 study, mice were given a single dose of  NMN in water.

NMN  levels in blood showed it is quickly absorbed from the gut into blood circulation within 2–3 min and then cleared from blood circulation into tissues within 15 min

 

 

The chart at right shows levels of a double labeled NAD+ (C13-d-nad+) in liver and soleus muscle at 10 and 30 minutes after oral administration of double labeled NMN.

This clearly shows that NMN makes its way through the liver, into muscle, and is metabolized to NAD+ in 30 minutes (23) .

According to Dr Sinclair, the speed at which the NMN is utilized implies that there may be a transporter that directly uptakes NMN into cells and tissues(8).

Orally administered NMN is quickly absorbed, efficiently transported into blood circulation, and immediately converted to NAD+in major metabolic tissues (23).

NMN INCREASES NAD+ and SIRT1 DRAMATICALLY IN ORGANS

In this 2017 study, NMN supplementation for 4 days significantly elevated NAD+ and SIRT1, which protected the mice from Kidney damage.

NAD+ and SIRT1 levels were HIGHER in OLD Mice than in YOUNG Mice that did not receive NMN.

Read more about NMN here

[post-content id=59982]

Decline of NAD+ during Aging, Age-Related Diseases, and Cancer

Several evidences suggest a decline in NAD+ levels while we age, connecting NAD+ deficits to age-related diseases and cancer.

Inflammation increases during the aging process possibly due to the presence of senescent cells [1].

CD38 and bone marrow stromal cell antigen-1 (BST- 1) may provide explanations to NAD+ decline during aging.

CD38 is a membrane-bound hydrolase implicated in immune responses and metabolism. NAD+ can be degraded through its hydrolysis, deacetylation, or by NAD+ nucleosidases (also called NAD+ hydrolases or NADases) such as CD38.

Expression and activity of CD38 increase in older mice, promoting NMN degradation in vivo, responsible for NAD+ decline and mitochondrial dysfunctions [2].

Interestingly, loss of CD38 inhibits glioma progression and extends the survival of glioma- bearing mice.

Targeting CD38 in the tumor microenvironment may clearly serve as a novel therapeutic approach to treat glioma [3].

 

Daratumumab, a CD38 monoclonal antibody, rep- resents a first-in-class drug for the treatment of multiple myeloma. It promotes T cell expansion through inhibition of CD38+ immunosuppressive cells, improving patients’ responses [4].

These findings suggest that NAD+ boosters should be combined with CD38 inhibitors for a more efficient antiaging therapy.

 

NAD+ Biosynthesis Decreases during Aging, Age-Related Diseases, and Cancer 

NAD+ increases can also occur independently of the Preiss–Handler route. NAM and NR are important NAD+ precursors first converted to nicotinamide mononucleotide (NMN) by nicotinamide phosphoribosyltransferase (NAMPT) and NR kinase (NRK), respectively. NMN is then transformed into NAD+ by NMN adenylyltransferase [36].

As we age, our bodies undergo changes in metabolism, and a key part of these processes may affect de novo NAD+ synthesis, also called the L-tryptophan/kynurenine pathway (see Figure IB in Box 1). In mammals, the use of the de novo NAD+ biosynthetic pathway is limited to a few specific organs.

Finally, dysregulation of the kynurenine pathway is also linked to genetic disorders and age-related diseases such as obesity and cancer [14,15]. These age-associated changes in de novo NAD+ biosynthesis may have the potential to impact several biological processes, and thus contribute to age-related diseases and cancer in the elderly.

Animal models mimicking downregulation of NAD+ biosyn-thesis are needed to modulate its activity and understand its pathophysiological relevance in age-related pathologies and cancer.

Boosting NAD+ with Niacin in Age-Related Diseases and Cancer 

In humans, a lack of nicotinic acid (NA, also called niacin) in the diet causes the vitamin B3 deficiency disease pellagra, characterized by changes in the skin with very characteristic  pigmented sunburn-like rashes developing in areas that are exposed to sunlight. Likewise, people with chronic L-tryptophan-poor diets or malnutrition develop pellagra.

Furthermore, several epidemiologic studies in human reported an association between incidence of certain types of cancers and niacin deficiency [27].

In this regard, low dietary niacin has also been associated with an increased frequency of oral, gastric, and colon cancers, as well as esophageal dysplasia.

In some populations, it was shown that daily supplementation of niacin decreased esophageal cancer incidence and mortality. Although the molecular mechanisms of niacin deprivation and cancer incidence are not well understood, it has been recently reported that NAD+ depletion leads to DNA damage and increased tumorigenesis, and boosting NAD+ levels is shown to play a role in the prevention of liver and pancreatic cancers in mice [19,28,29].

Thus, malnutrition through inadequate amounts and/or diversity of food may affect the intra- cellular pools of nicotinamide and NAD+ thereby influencing cellular responses to genotoxic damage, which can lead to mutagenesis and cancer formation [19,27]. NAD+ boosters are therefore essential in patients at risk of exposure to genotoxic and mutagenic agents, including ionizing or UV radiations or, DNA damaging chemicals.

In addition, niacin deficiency in combination with carcinogenic agents was described to induce and increase tumorigenesis in rats and mice.

For instance, in rats, the lack of niacin together with carcinogen treatment increased tumorigenesis and death of rats [30,31]. Additionally, in mice, the incidence of skin tumours induced by UV was significantly reduced by local application of NAM or by niacin supplementation in the diet [32].

Boosting NAD+ with NAM in Age-Related Diseases and Cancer 

Recent research has focused on uncovering the consequences of a decrease in NAD+ during aging using age-related disease models. In PGC1a knockout mouse, a model of kidney failure, NAD+ levels are reportedly decreased, and boosting NAD+ by NAM improves kidney function [33].

NAM injections during four days re-establish local NAD+ levels via nicotinamide phos- phoribosyltransferase (NAmPRTase or NAMPT) activation and improve renal function in postischaemic PGC1a knockout mice [33].

Surgical resection of small renal tumors can induce kidney ischemia severely affecting the renal function. Therefore, NAD+ boosters can be beneficial to protect the organ from severe injury.

Moreover, in a model of muscular dystrophy in zebrafish, NAD+ increases, which functions as an agonist of muscle fiber–extracellular matrix adhesion, and corrects dystrophic phenotype recovering muscle architecture [34].

Boosting NAD+ with NR in Age-Related Diseases and Cancer 

Further research has extensively used NR to ameliorate the effects of NAD+ deficits in pleiotropic disorders. NR naturally occurs in milk [35,36]. NR is converted to NAD+ in two step reactions by nicotinamide riboside kinases (NRKs)-dependent phosphorylation and adenylylation by nicotinamide mononucleotide adenylyl transferases (NMNATs) [36].

It is considered to be a relevant NAD+ precursor in vivo. Evidences demonstrate the beneficial effect of NR in skeletal muscle aging [37,38] and mitochondrial-associated disorders, such as myopathies [39,40] or those characterized by impaired cytochrome c oxidase biogenesis affecting the respiratory chain [41].

In line of these findings, a mouse model of Duchenne muscular dystrophy present significant reductions in muscle NAD+ levels accompanied with increased poly-ADP-ribose polymerases (PARP) activity, and reduced expression of NAMPT [42].

Replenishing NAD+ stores with dietary NR supplementation improved muscle function in these mice through better mitochondrial function [42].

Additionally, enhanced NAD+ concen- trations by NR are apparently beneficial for some neurodegenerative diseases [43], as well as in noise-induced hearing loss [44].

NR-mediated NAD+ repletion is also protective, and even therapeutic, in certain metabolic disorders associated with cancer, such as fatty liver disease [28,45] and type 2 diabetes [28,46]. Metabolic disorders characterized by defective mitochon- drial function could also benefit from an increase in NAD+ levels.

Indeed, stimulation of the  oxidative metabolism in liver, muscle, and brown adipose tissue potentially protects against obesity [47]. Interestingly, NAMPT protein levels are not affected in chow- and high fat diet (HFD)-treated mice fed with NR, arguing that in models of obesity, NR directly increases NAD+ levels without affecting other salvage reactions [47].

Recently, diabetic mice with insulin resistance and sensory neuropathy treated with NR reportedly show a better glucose toler- ance, reduced weight gain and liver damage, and protection against hepatic steatosis and sensory and diabetic neuropathy [48].

 

Boosting NAD+ with NMN in Age-Related Diseases and Cancer 

NMN is also a key biosynthetic intermediate enhancing NAD+ synthesis and ameliorates various pathologies in mouse disease models [49,50].

Very recent research demonstrate that a 12- month-long NMN administration to regular chow-fed wild-type C57BL/6 mice during normal aging rapidly increases NAD+ levels in numerous tissues and blunts age-associated physio- logical decline in treated mice without any toxic effects [49]. NMN is also beneficial in treating age- and diet-induced diabetes, and vascular dysfunction associated with aging in mice [51,52].

Administration of NMN also protects the heart of mice from ischemia-reperfusion injury [53] and restores mitochondrial function in muscles of aged mice [37,54].

It has been speculated that NMN is a circulating NAD+ precursor, due to the extracellular activity of NAMPT [55]. However, the mechanisms by which extracellular NMN is converted to cellular NAD+ still remain elusive.

On the one hand, it is reported that NMN is directly trans- ported into hepatocytes [51]. On the other hand, NMN can be dephosphorylated to NR to support elevated NAD+ synthesis [56–59].

It is recently shown that NAM can be metabolized extracellularly into NMN by extracellular NAMPT. NMN is then converted into NR by CD73 [60]. Hence, NR is taken up by the cells and intracellularly phosphorylated firstly into NMN by NRKs and then, converted into NAD+ by NMNATs [60] (Figure 3).

Thus, mammalian cells require conversion of extracellular NMN to NR for cellular uptake and NAD+ synthesis. Consistent with these findings, in murine skeletal muscle specifically depleted for NAMPT, administration of NR rapidly restored muscle mass by entering the muscles and replenishing the pools of NAD+ through its conversion to NMN [38].

Interestingly, mice injected with NMN had increased NAM in their plasma that may come after initial conversion of NMN into NR [60]. However, degradation of NR into NAM could only be observed when cells were cultured in media supplementing with 10% FBS [60].

Finally, it is important to note that NR is stably associated with protein fractions in milk with a lifetime of weeks [35].

Notably, as reported above, NMN may be degraded by CD38 in older mice promoting NAD+ decline and mitochondrial dysfunctions [2], suggesting that NR may be more efficient than NMN in elderly.

Yet, the beneficial synergistic activation of sirtuins and metabolic pathways to replenish NAD+ pools cannot be excluded. However, given its efficient assimilation and high tolerance, NR represents still the most convenient and efficient NAD+ booster.

Overall, these findings suggest that NAD+ decrease in disease models and NAD+ precursors (NAM, NR or NMN) may circumvent NAD+ decline to generate adequate levels of NAD+ during aging and thus be used as preventive and therapeutic antiaging supplements.

NMN and NR  supplementations may be equivalent strategies to enhance NAD+ biosynthesis with their own limitations.

Side-Effects of Some NAD+ Boosters 

Clearly, several intermediates of the salvage pathway can be considered to boost NAD+ levels but some have contraindications. High doses of NA given to rats are needed to robustly increase NAD+ levels [61].

Additionally, relevant and unpleasant side effects through NA-induced prostaglandin- mediated cutaneous vasodilation (flushing) affecting patient compliance are due to the activation of the G-protein-coupled receptor GPR109A (HM74A) and represent a limitation in the pharma- cological use of NA [62].

NAM is much less efficient than NA as a lipid lowering agent and has also several side effects; in particular, it causes hepatic toxicity through NAM-mediated inhibition of sirtuins [63].

The metabolism of these conventional compounds to NAD+ is also different, as NA is converted via the three-step Preiss–Handler pathway, whereas NAM is metabolized into NMN via NAMPT and then to NAD+ by NMNATs [64]

Manipulating NAD+ by Manipulating Enzyme Activity of Salvage Reactions 

Enhancing the activity of enzymes that participate in salvage reactions can also be a strategic intervention to increase NAD+ concentrations. Different studies have addressed the importance of regulating the activity of NAMPT during disease, including metabolic disorders and cancer.

NAMPT is necessary in boosting NAD+ pools via the salvage pathway.

Consequently, NAMPT deletion provokes obesity-related insulin resistance, a phenotype rescued by boosting NAD+ levels in the white adipose tissue by giving NMN in drinking water [67].

Conversely, in a mouse model for atherosclerosis, NAMPT depletion promotes macro- phage reversal cholesterol transport, a key process for peripheral cholesterol efflux during atherosclerosis reversion [68].

Other recent reports suggest that NAMPT downregulation could be beneficial in treating pancreatic ductal adenocarcinoma [69,70] and colorectal cancer [71].

Recent findings show that Duchenne muscular dystrophy was accompanied by reduced levels of NAMPT in mice [42]. Moreover, NAMPT knockout mice exhibit a dramatic decline in intramuscular NAD+ content, accompanied by fiber degeneration and progressive loss of both muscle strength and treadmill endurance.

NR treatment induced a modest increase in intra- muscular NAD+ pools but sufficient to rapidly restore muscle mass. Importantly, overexpres- sion of NAMPT preserves muscle NAD+ levels and exercise capacity in aged mice [38].

Inhibitors against NAMPT are being used in several phase II clinical trials as anticancer therapy.

Given that NAMPT activation is important to boost NAD+ levels, therapy involving NAMPT inhibition should be considered with caution. Although levels of NAD+ remain to be determined in models with NAMPT depletion, further investigation on the effects of NAMPT modulation is clearly required.

The specific mechanisms and actual benefits of regulation of NAMPT activity remain elusive, evidencing the need of more specific disease models.

 

Can Dietary Restriction and Protein Catabolism Maintain NAD+ Levels?
Among the questions that still remain not well understood is why DR profoundly increases lifespan? Can DR affect NAD+ levels?

It is well established that overfeeding and obesity are important risk factors for cancer in humans [129] and obesity-induced liver and colorectal cancer, among others, can shorten lifespan.

Earlier research has also shown that both increased physical activity and reduction in caloric intake (without suffering malnourishment) can extend lifespan in yeasts, flies, worms, fish, rodents, and primates [3–8].

Furthermore, a recent study pointed to the importance of the ratio of macronutrients more than the caloric intake as the determinant factor in nutrition-mediated health status and lifespan extension [9].

Although in humans it is difficult to measure the beneficial effects of DR and currently there is no reliable data that describe the consequences of significantly limiting food intake, some studies have assessed how DR affects health status.

People practicing DR seem to be healthier, at least based on risk parameters such as LDL cholesterol, triglycerides, and blood pressure [130].

Activation of the salvage pathways during DR could be turned on and glucose restriction can stimulate SIRT1 through activation of the AMPK-NAMPT pathway resulting in inhibition of skeletal myoblast differentiation [131].

Interestingly, effects of NMN supplementation and exercise on glucose tolerance in HFD-treated mice are very similar [132].

Even though these effects are tissue-specific since exercise predominantly affects muscle, whereas NMN shows major effects in liver, and that mechanism of action can be different, exercise and NMN predominantly affect mitochondrial functions and may both contribute to the boost of NAD+.

It is thus tempting to speculate that L-tryptophan concentrations and thus the de novo NAD+ biosynthesis could fluctuate during DR ameliorating the aging process.

Recent studies in humans and mice suggest that moderate exercise can increase blood NAD+ levels and decrease L-tryptophan levels [137].

A possible explanation for this phenomenon is that DR,  and/or exercise, can induce autophagy and promote the release of several metabolites and essential amino acids [138].

 

Conclusion

 

Aging is proposed to be responsible for diverse pathologies, however, it should be considered as a disease among other diseases that appear in time while individuals age.

Although some questions still remain unclear, NAD+ precursors may present possible therapeutic solutions for the maintenance of NAD+ levels during aging and thus may provide prophylaxis to live longer and better.

Although more research is needed to understand the efficacy as well as potential adverse side effects of NAD+ Replacement Therapies in humans, recent studies already provided some pharmacological properties, showing low toxicity and high effectiveness.

 

 

[post-content id=59982]

 

 

 

References:

[post-content id=55017]

 

 

RESTORNG NAD+ – RESEARCH


Aging

Experiments with mice have mostly focused on treating specific disease conditions, but  in the process, some have noted increase in lifespan even though the NAD boosting therapies were commenced quite late in life (22).

Sirtuins are well-known longevity regulators, and their decreased function with age might at least be partially explained by a systemic decline in NAD+ levels upon aging  (40). Rising NAD+ content, followed by sirtuin activation, has been reported to increase lifespan in yeast, worms, and mice (22).

Administration of NR, NMN, or NAM recovered NAD+ content and protected against aging-related complications, such as mitochondrial dysfunction (24, 41, 23), decline in physical performance (23,29) and muscle regeneration (22), arterial dysfunction (42), decline in vision (43, 23), including glaucoma (44), and age-associated insulin resistance (23).

The most striking benefits of NAD+ supplementation on aging were observed in several rare diseases linked to abnormal DNA repair that are typified by accelerated aging, such as the Cockayne syndrome group B (CSB), xeroderma pigmentosum group A (XPA), or ataxia-telangiectasia (A-T).

In a mouse model of CSB, neurons show mitochondrial defects, which have an impact on the cerebellum and inner ear. Administration of PARP inhibitors or the NAD+ precursor, NR, to csb / animals attenuated many of the phenotypes of CSB and restored altered mitochondrial function in their neurons.

Another DNA damage repair disorder is XPA, which is also characterized by mitochondrial alterations and reduced NAD+-SIRT1 signaling due to the overactivation of PARP1 (45).

Treatment with NAD+ precursors, NR and NMN rescued the XPA phenotype in cells and worms.  Restoring the NAD+/SIRT1 pathway, by NR and NMN administration to C. elegans and mice, improved A-T neuropathology (45).

Metabolic disorders

The importance of NAD+ as a metabolic regulator has been demonstrated by its efficacy to attenuate many features of the metabolic syndrome, a cluster of pathologies including insulin resistance, fatty liver, dyslipidemia, and hypertension, with increased risk of developing type 2 diabetes and heart failure.

Different approaches aiming to raise NAD+ levels were shown to provide protection against obesity, such as (i) inhibition of NAD+ consumers, PARPs (29) and CD38 (Barbosa et al, 2007), (ii) administration of NAD+ precursors, such as NR (49, 45T,51) or NMN (Yoshino et al, 2011), (iii).

NAD+ boosting was also efficient to improve glucose homeostasis in obese, prediabetic, and T2DM animals (29,46,51). Likewise, reestablishing NAD+ levels with NR or PARP inhibitors also protected from non-alcoholic steatohepatitis (NASH) (46) as well as alcoholic steatohepatitis (46).

Muscle function

Increase in muscle NAD+ content, resulting from NR administration or PARP inhibition, improved muscle function and exercise capacity in mice (49), including in aged animals (22).

Interestingly, muscular dystrophy is characterized by a dramatic drop in NAD+ in the muscle (Ryu et al, 2016). NR administration to the mdx mouse, a model for muscular dystrophy, improved muscle function by enhancing bioenergetics, attenuating inflammation and fibrosis (Ryu et al, 2016), as well as, by favoring regeneration and preventing the exhaustion and senescence of muscle stem cells, typical to the mdx mice (22).

The beneficial effects of improving muscle bioenergetics are also illustrated in models of mitochondrial myopathies. Increasing muscle NAD+ levels by the administration of NR or a PARP inhibitor preserved muscle function in two different models of mitochondrial myopathy (Cerutti et al, 2014; Khan et al, 2014).

Similar benefits on mitochondrial myopathy were seen with the AMPK agonist, AICAR (Viscomi et al, 2011), which may at least in part be due to the recovery of NAD+ content upon AMPK activation.,

Cardiac function

Exposing the heart to different types of stresses was reported to result in a decline in cardiac NAD+ content (Pillai et al, 2005, 2010; Karamanlidis et al, 2013; Yamamoto et al, 2014). For instance, cardiomyocyte hypertrophy is characterized by a drop in cellular NAD+ levels. Supplementation with NAD+ was hence protective against cardiac hypertrophy in mice, and these anti-hypertrophic effects were in part attributed to the activation of SIRT3 (Pillai et al, 2010).

Cardiac ischemia is another condition causing a steep decrease in NAD+ levels. NMN administration protected the mice from ischemic injury via the recovery of cardiac NAD+ content and subsequent SIRT1 activation (Yamamoto et al, 2014).

Similarly, cardiac-specific overexpression of NAMPRT in mice increased NAD+ content and reduced the extent of myocardial infarction and apoptosis in response to prolonged ischemia and ischemia/reperfusion (Hsu et al, 2009).

Maintaining NAD+ levels in pressure-overloaded hearts is crucial for myocardial adaptation and protection from heart failure, as demonstrated by NMN administration to mice treated with the NAMPRT inhibitor FK866 (Yano et al, 2015) and to cardiac-specific mitochondrial complex I-deficient mice (Lee et al, 2016).

In a mouse model of heart failure caused by iron deficit, reconstituting NAD+ content also improved mitochondrial quality, protected cardiac function, and increased lifespan (Xu et al, 2015). Similarly, NR administration improved cardiac function in aged mdx mice, which, like muscular dystrophy patients, display cardiomyopathy (Ryu et al, 2016).

Renal function

Multiple studies demonstrated the loss of SIRT1 and SIRT3 activity as a key feature of kidney dysfunction, including kidney abnormalities linked with aging (Koyama et al, 2011,53, Morigi et al, 2015; Ugur et al, 2015; Guan et al, 2017).

Acute kidney injury (AKI) is characterized by a reduction in NAD+ content and NAMPRT expression (Morigi et al, 2015; Ugur et al, 2015). Promoting NAD+ synthesis via NAM or NMN supplementation was reported to mitigate AKI in ischemia/reperfusionand cisplatininduced mouse models of AKI (Tran et al, 2016; Guan et al, 2017).

Furthermore, administration of the AMPK agonist, AICAR, which positively impacts on NAD+ levels (48), was protective against cisplatin-induced AKI in SIRT3-dependent manner (Morigi et al, 2015). Although no NAD+ quantification was performed in this particular study, the involvement of SIRT3, as well as the increase in Namprt expression detected upon AICAR administration, points toward a potential increase in NAD+ levels (Morigi et al, 2015).

Kidney mesangial cell hypertrophy is also characterized by a depletion of NAD+ content (53) and restoring intracellular NAD+ levels via supplementation with exogenous NAD+ prevented its onset by activating SIRT1 and SIRT3 (53z).

Neurodegeneration

NAD+ boosting has also been shown to be neuroprotective. Raising NAD+ levels protects against neuronal death induced by ischemic brain (Klaidman et al, 2003; Sadanaga-Akiyoshi et al, 2003; Kabra et al, 2004; Feng et al, 2006; Kaundal et al, 2006; Zheng et al, 2012) or spinal cord injuries (Xie et al, 2017).

Axonal degeneration is considered as an early pathological mechanism in this type of neurodegeneration. An accumulating amount of data indicates that axonal degeneration is not only limited to ischemic brain and spinal cord injuries, but constitutes a hallmark process, preceding neuronal death, in a much larger spectrum of disease states, including traumatic brain injury, inflammatory disorders, like multiple sclerosis, and degenerative disorders, such as Alzheimer’s and Parkinson’s diseases (Lingor et al, 2012; Johnson et al, 2013).

Degenerating axons show a decrease in NAD+ content (Wang et al, 2005; Gerdts et al, 2015), while replenishing NAD+ by supplementing NAM (Wang et al, 2005), NR and NMN (Sasaki et al, 2006), and high doses of NAD+ (Araki et al, 2004), or overexpressing enzymes involved in NAD+ biosynthesis (Araki et al, 2004; Sasaki et al, 2006) delayed axonal degeneration.

In line with this, supplementation with NAM, NMN, or NR was neuroprotective in rodent models of Alzheimer disease (Qin et al, 2006; Gong et al, 2013; Liu et al, 2013; Turunc Bayrakdar et al, 2014; Wang et al, 2016a), and supplementation with NAM or LOF of PARP were protective in Drosophila models of Parkinson’s disease (Lehmann et al, 2017).

NAD+ depletion is also involved in the neurodegeneration induced by highly toxic misfolded prion protein (Zhou et al, 2015). Replenishment of intracellular NAD+ stocks, either by providing NAD+ or NAM, rescued the neurotoxic effects of protein aggregates (Zhou et al, 2015). Importantly, restoring NAD+ content is not exclusively protecting neurons, since it has also been reported to prevent the death of astrocytes (Alano et al, 2004).

P7C3, a compound that enhances neurogenesis (Pieper et al, 2010) and that was neuroprotective in mouse models of Parkinson’s disease (De Jesus-Cortes et al, 2012), amyotrophic lateral sclerosis (Tesla et al, 2012) and brain injury (Yin et al, 2014), was subsequently identified as an NAMPRT activator (Wang et al, 2014a). Therefore, the beneficial effects of P7C3 on neuron preservation seem at least in part to be due to a NAMPRT-mediated increase in NAD+ levels (Wang et al, 2014a).

Nicotinamide riboside supplementation recovered depressed sensory and motor neuron conduction velocities and thermal insensitivity in T2DM mice (51) and alleviated chemotherapy-induced peripheral neuropathy in rats (Hamity et al, 2017), indicating that NAD+ also is beneficial in the peripheral neuronal system.

NAD+ boosting was also able to protect mice from loss of vision and hearing (Shindler et al, 2007; Brown et al, 2014). Intravitreal injections of NR in mice attenuated optic neuritis in a dose-dependent manner (Shindler et al, 2007).

Even if no NAD+ quantification was performed in this study, SIRT1 activity was necessary for the neuroprotective effects of NR, since the protection was blunted in the presence of sirtinol, a SIRT1 inhibitor (Shindler et al, 2007). Furthermore, systemic administration of NAM and overexpression of Nmnat1 had spectacular effects on vision in DBA/2J mice, which are prone to glaucoma (44).

Noise exposure results in degeneration of the neurons innervating the cochlear hair cells. Increase in NAD+ levels induced by NR administration prevented against noise-induced hearing loss and neurite degeneration (Brown et al, 2014).

In line with this, CR was shown to protect against cochlear cell death and aging-associated hearing loss in a Sirt3-dependent manner (Someya et al, 2010). It is therefore tempting to speculate that this improvement could also be associated with increased NAD+ levels uponCR, though no direct measurements of NAD+ levels were performed in this study.

 

Manipulations of NAD+ concentrations have demonstrated multiple beneficial effects in a large spectrum of diseases in animal models . Translating these effects into clinical benefits now becomes one of the main challenges.

The fact that the long-term administration of the NAD+ precursor molecules showed no deleterious effects in animals should be considered promising.

As such, administration of NMN for 12 months demon- strated no toxicity in mice (23).

Similarly, administrtion of NR to mice for a duration of 5–6 months (Gong et al, 2013), 10 months (22), and 12 months (Tummala et al, 2014) showed no obvious adverse effects.

Another NAD+ precursor, NAM, has also been already tested in humans and protected b-cell function in type 1 diabetes patients.

Furthermore, a slow release form of NA (acipimox) was effective in inducing mitochondrial activity in skeletal muscle of type 2 diabetic patients (van de Weijer et al, 2015).

MCT Oil aids weight loss, increases energy and endurance

Interest in medium-chain triglycerides (MCT) has grown rapidly over the last few years.

This is partly due to the widely-publicized benefits of coconut oil, a rich source of them.

Many advocates boast that medium-chain triglycerides (MCTs) can aid in weight loss.

In addition, MCT oil has become a popular supplement among athletes and bodybuilders.

Here is everything you need to know about MCTs, including what they are and what health benefits they may have.

What is MCT?

MCT stands for medium-chain triglycerides, which are fats found in foods like coconut oil. They are metabolized differently than the long-chain triglycerides (LCT) found in most other foods.

MCT oil is a supplement that contains a lot of these fats, and is claimed to have many health benefits.

Triglyceride is simply the technical term for fat. Triglycerides have two main purposes — they are transported into cells and burned for energy, or stored as body fat.

Triglycerides are named after their chemical structure, more specifically the length of their fatty acid chains. All triglycerides are made up of a glycerol molecule and 3 fatty acids.

The majority of fat in your diet is made up of long-chain fatty acids, which contain 13–21 carbons. Short-chain fatty acids have fewer than 6 carbon atoms.

In contrast, the medium-chain fatty acids in MCTs have 6–12 carbon atoms.

These are the main medium-chain fatty acids:

  • C6: Caproic acid or hexanoic acid.
  • C8: Caprylic acid or octanoic acid.
  • C10: Capric acid or decanoic acid.
  • C12: Lauric acid or dodecanoic acid.

Some experts argue that C6, C8 and C10, which are referred to as the “capra fatty acids,” reflect the definition of MCT more accurately than C12 (lauric acid) (1).

Bottom Line: Medium-chain triglycerides (MCT) are types of fatty acids containing 6–12 carbons. They include caproic acid (C6), caprylic acid (C8), capric acid (C10) and lauric acid (C12).

Medium-Chain Triglycerides are Metabolized Differently

Bottle of Coconut Oil and Half a Coconut

Because of the shorter chain length of the fatty acids, MCTs are rapidly broken down and absorbed into the body.

Unlike longer-chain fatty acids, MCTs go straight to the liver.

There they can be used as an instant energy source or turned into ketones, which are substances produced when the liver breaks down large amounts of fat.

Unlike regular fatty acids, ketones can cross from the blood to the brain. This provides an alternative energy source for the brain, which ordinarily uses glucose for fuel.

Because the calories contained in MCTs are more efficiently turned into energy and used by the body, they are less likely to be stored as fat.

Bottom Line: Due to their shorter chain length, medium-chain triglycerides are more rapidly broken down and absorbed into the body. This makes them a fast energy source and less likely to be stored as fat.

Sources of Medium-Chain Triglycerides

There are two main ways to increase the amount of MCT in your diet — through whole food sources or supplements such as MCT oil.

Whole Food Sources

A Coconut and Coconut Oil With a Blue Background

These foods are the richest in medium-chain triglycerides, shown as the percentage of fatty acids that are MCTs (2):

  • Coconut oil: Greater than 60%.
  • Palm kernel oil: Greater than 50%.
  • Dairy products: 10–12%.

Although the sources above are rich in MCTs, their compositions vary. For example, coconut oil contains all four types of MCTs, plus a small amount of LCTs.

However, its MCTs consist of greater amounts of lauric acid (C12) and smaller amounts of the “capra fatty acids” (C6, C8 and C10). In fact, coconut oil is about 50% lauric acid (C12), making it one of the best natural sources of this fatty acid.

Compared to coconut oil, dairy sources tend to have a higher proportion of capra fatty acids (C6, C8 and C10) and a lower proportion of lauric acid (C12).

In milk, capra fatty acids make up 4–12% of all fatty acids, and lauric acid (C12) makes up 2–5% (3).

Bottom Line: Whole food sources of MCTs include coconut oil, palm kernel oil and dairy products. However, their MCT composition varies.

MCT Oil

MCT oil is a highly concentrated source of medium-chain triglycerides.

It is man-made, through a process called fractionation. This involves extracting and isolating the MCTs from coconut or palm kernel oil.

MCT oils generally contain either 100% caprylic acid (C8), 100% capric acid (C10) or a combination of the two.

Caproic acid (C6) is not normally included due to its unpleasant taste and smell. Lauric acid (C12) is often missing or present in only small amounts (4).

Given that lauric acid is the main component in coconut oil, be careful of manufacturers who market MCT oils as “liquid coconut oil,” which is misleading.

Many people debate whether lauric acid reduces or enhances the quality of MCT oils.

Many advocates market MCT oil as better than coconut oil because caprylic acid (C8) and capric acid (C10) are thought to be more rapidly absorbed and processed for energy than lauric acid (C12).

Since C13 is a long-chain fatty acid and lauric acid (C12) is quite similar in structure, some experts argue that it might act more like a long-chain fat, making it less valuable.

Although evidence supports that lauric acid is more rapidly absorbed in the body than LCTs, one study suggests that lengthening the carbon chain by 2 carbons can slow down the rate of diffusion by 100 times (567).

Therefore, compared to other medium-chain triglycerides, lauric acid may be a slightly less efficient way to obtain energy. However, it also has unique health benefits.

For example, lauric acid has even more anti-microbial properties than caprylic acid (C8) or capric acid (C10), meaning it can help kill harmful bacteria and viruses (89).

Bottom Line: MCT oil is an easy way to get large concentrations of certain MCTs. It usually contains C8, C10 or a combination of the two.

Which Should You Choose?

The source best for you depends on your goals and the amount of medium-chain triglycerides you want.

It is not clear what dose is needed to obtain potential benefits. In studies, doses range from 5–70 grams (0.17–2.5 oz) of MCT daily.

If your aim is to achieve overall good health, using coconut oil or palm kernel oil in cooking is probably sufficient.

However, for higher doses you might want to consider MCT oil.

One of the good things about MCT oil is that it has virtually no taste or smell. It can be consumed straight from the jar or alternatively mixed into food or drinks.

Another great thing about MCT oil is the price.  This 32 ounce bottle  at  Amazon is around $24.  That’s nearly 9,000 calories in the bottle, which is the calories most people consume in 4-5 days.  So per calorie, its less $ than McDonalds!

Bottom Line: Coconut and palm kernel oils are rich sources of medium-chain triglycerides, but MCT oil supplements contain much larger amounts.

MCT Oil May Help With Weight Loss in Several Ways

Woman Holding Measuring Tape Around Her Waist

There are several ways that MCTs may help with weight loss, including:

  • Lower Energy Density: MCTs provide around 10% fewer calories than LCTs, or 8.4 calories per gram for MCTs versus 9.2 calories per gram for LCTs (10).
  • Increase Fullness: One study found that compared to LCTs, MCTs resulted in greater increases in peptide YY and leptin, two hormones that help reduce appetite and increase feelings of fullness (11).
  • Fat Storage: Given that MCTs are absorbed and used more rapidly than LCTs, they are less likely to be stored as body fat (10).
  • Burn Calories: Studies in animals and humans show that MCTs (mainly C8 and C10) may increase the body’s ability to burn fat and calories (12131415161718).
  • Greater Fat Loss: One study found that an MCT-rich diet caused greater fat burning and fat loss than a diet higher in LCTs. However, these effects may disappear after 2–3 weeks once the body has adapted (18).
  • Low-carb Diets: Very low-carb or ketogenic diets are a effective ways to lose weight. Given that MCTs produce ketones, adding them to your diet can increase the number of carbs you can eat while staying in ketosis.

Bottom Line: MCTs may aid in weight loss through reduced calorie intake, increased fullness, less fat storage, improved calorie burning and increased ketones on low-carb diets.

Do MCTs Actually Cause Weight Loss?

Weight Scale

While many studies have found positive effects of MCTs on weight loss, other studies have found no effects (19).

In a review of 14 studies, 7 evaluated fullness, 8 measured weight loss and 6 assessed calorie-burning.

Only one study found increases in fullness, while 6 studies found reductions in weight and 4 found increased calorie burning (20).

In another review of 12 animal studies, 7 reported a decrease in weight gain and 5 found no differences. In terms of food intake, 4 detected a decrease, 1 detected an increase and 7 found no differences (21).

In addition, the amount of weight loss caused by MCTs is actually very modest.

A review of 13 studies found that on average the amount of weight lost on a diet high in MCTs was only 1.1 lbs (0.5 kg) over 3 weeks or more when compared to a diet high in LCTs (19).

Another study found that a diet rich in medium-chain triglycerides resulted in a 2-lb (0.9-kg) greater weight loss than a diet rich in LCTs over a 12 week period (22).

Further high-quality studies are needed to determine how effective MCTs are for weight loss and what amounts need to be taken to experience benefits.

Bottom Line: A diet high in medium-chain triglycerides may help with weight loss, although the effect is generally quite modest.

Evidence for MCTs Enhancing Exercise Performance is Weak

MCTs are thought to increase energy levels during high-intensity exercise and serve as an alternative energy source, sparing glycogen stores.

This may positively affect endurance and have benefits for athletes on low-carb diets.

One animal study found that mice fed a diet rich in medium-chain triglycerides did much better in swimming tests than mice fed a diet rich in LCTs (23).

Additionally, consuming food containing MCTs instead of LCTs for 2 weeks resulted in longer duration of high-intensity exercise among recreational athletes (24).

Although the evidence seems positive, there are not enough studies available to confirm this benefit, and the overall link is weak (25).

Bottom Line: The link between MCTs and improved exercise performance is weak and more studies are needed to confirm these claims.

Other Potential Health Benefits of MCT oil

A Jar of Coconut Oil and a Teaspoon

The use of medium-chain triglycerides and MCT oil has been associated with several other health benefits.

Cholesterol

MCTs have been linked to lower cholesterol levels in both animal and human studies.

For example, calves consuming MCT-rich milk had lower cholesterol than calves fed LCT-rich milk (26).

Several studies in rats have linked coconut oil to improved cholesterol levels and higher antioxidant vitamin levels (2728).

A study in 40 women found that consuming coconut oil along with a low-calorie diet reduced LDL cholesterol and increased HDL cholesterol, compared to women consuming soybean oil (29).

Improvements in cholesterol and antioxidant levels may lead to a reduced risk of heart disease over the long term.

However, it is important to note that some older studies report that MCT supplements had no effects or even negative effects on cholesterol (3031).

One study in 14 healthy men reported that MCT supplements negatively affected cholesterol, increasing total cholesterol and LDL cholesterol (31).

Bottom Line: Diets high in MCT-rich foods like coconut oil may have benefits for cholesterol levels. However, the evidence is mixed.

Diabetes

MCTs may also help lower blood sugar levels. In one study, diets rich in MCTs increased insulin sensitivity in adults with type 2 diabetes (32).

Another study in 40 overweight individuals with type 2 diabetes found that supplementing with MCTs improved diabetes risk factors. It reduced body weight, waist circumference and insulin resistance (33).

However, evidence for the use of medium-chain triglycerides in diabetes is limited. More research is needed to determine its full effects.

Bottom Line: MCTs may help lower blood sugar levels by reducing insulin resistance. However, more research is needed to confirm this benefit.

Brain Function

MCTs produce ketones, which act as an alternative energy source for the brain and can therefore improve brain function.

Recently there has been more interest in the use of MCTs to treat or prevent brain disorders like Alzheimer’s disease and dementia (34).

One major study found that MCTs improved learning, memory and brain processing in people with mild to moderate Alzheimer’s disease. However, this was only effective in people containing a particular gene, the APOE4 gene (35).

Overall, the evidence is limited to short studies with small sample sizes, so more research is needed.

Bottom Line: MCTs may improve brain function in people with Alzheimer’s disease who have a particular genetic make-up. More research is needed.

Other Medical Conditions

Because MCTs are an easily absorbed and digested energy source, they’ve been used for years to treat malnutrition and disorders that hinder nutrient absorption.

Conditions that benefit from medium-chain triglyceride supplements include diarrhea, steatorrhea (fat indigestion) and liver disease. Patients undergoing bowel or stomach surgery may also benefit.

Evidence also supports the use of MCTs in ketogenic diets treating epilepsy (36).

The use of MCTs allows children suffering from seizures to eat larger portions and tolerate more calories and carbs than on classic ketogenic diets (37).

Bottom Line: MCTs are effective at treating a number of clinical conditions including malnutrition, malabsorption disorders and epilepsy.

Dosage, Safety and Side Effects

Oil on a Spoon

MCT oil appears to be safe for most people.

It is not clear what dose is needed to obtain potential health benefits, but many supplement labels suggest 1–3 tablespoons daily.

There are currently no reported adverse interactions with medications or other serious side effects.

However, some minor side effects have been reported and include nausea, vomiting, diarrhea and an upset stomach.

These can be avoided by starting with small doses, such as 1 teaspoon, and increasing intake slowly. Once tolerated, MCT oil can be taken by the tablespoon.

Type 1 Diabetes and MCTs

Some sources discourage people with type 1 diabetes from taking medium-chain triglycerides due to the accompanying production of ketones.

It is thought that high levels of ketones in the blood may increase the risk of ketoacidosis, a very serious condition that can occur in type 1 diabetics.

However, the nutritional ketosis caused by a low-carb diet is completely different than diabetic ketoacidosis, a very serious condition caused by a lack of insulin.

In people with well-controlled diabetes and healthy blood sugar levels, the amount of ketones remain within a safe range even during ketosis.

There are limited studies available that explore the use of MCTs in type 1 diabetes. However, some have been conducted with no harmful effects (38).

Bottom Line: MCT oil is safe for most people, but there are no clear dosage guidelines. Start with small doses and gradually increase your intake.

Take Home Message

Medium-chain triglycerides have many potential health benefits including weight loss, lower cholesterol levels, improved insulin resistance, and improved endurance exercise.

For these reasons, adding MCT oil to your diet is highly recommended.