Methylene Blue May Protect Against Skin Aging

Methylene blue appears to slow and reverse aspects of the aging process in human skin

Described as “the first fully synthetic drug used in medicine”, methylene blue is a common and inexpensive chemical used to treat several conditions and is also a potent staining agent. Prior work has demonstrated it has significant potential to treat progeria and can reverse some aspects of aging in human cells. As progeria is classed as a premature aging condition in some respects, with many symptoms similar to those seen in ordinary elderly individuals, there has been hope it may emerge as a pro-longevity medicine. While animal studies using methylene blue to extend life have been lacklustre, lab work has suggested it may he significant benefits at low dosages.

A new cosmetic ingredient?

In new research published in Scientific Reports a research team has discovered methylene blue can make fundamental changes to skin cell gene expression; ameliorating many aspects of the aging process. Comparing and contrasting results to those using other potential longevity agents including N-Acetyl-L-Cysteine (NAC), MitoQ and MitoTEMPO (mTEM), the scientists tested varying levels of methylene blue on human fibroblast cells.

“I was encouraged and excited to see skin fibroblasts, derived from individuals more than 80 years old, grow much better in methylene blue-containing medium with reduced cellular senescence markers. Methylene blue demonstrates a great potential to delay skin aging for all ages”

A solution of methylene blue. Credit: amandabhslater

A solution of methylene blue. Credit: amandabhslater

2 strong markers of cellular senescence, senescence-associated beta-galactosidase and p16, were both reduced in methylene blue treated cells. When the researchers then tested the chemical on a 3D model of human skin containing different layers and structures, they found that methylene blue treatment in a topical form was able to improve several features. Methylene blue at a low dose was able to increase skin thickness and hydration – altering expression of extracellular matrix genes and upregulating elastin and collagen production while limiting levels of reactive oxygen species.

“This system allowed us to test a range of aging symptoms that we can’t replicate in cultured cells alone. Most surprisingly, we saw that model skin treated with methylene blue retained more water and increased in thickness—both of which are features typical of younger skin. We have already begun formulating cosmetics that contain methylene blue. Now we are looking to translate this into marketable products”

We will have to await further data to gain further confirmation on live human skin results. Methylene blue reacts to light exposure in a potentially damaging manner which may limit its application in the day.

Effects of subacute ingestion of chlorogenic acids on sleep architecture and energy metabolism through activity of the autonomic nervous system: a randomised, placebo-controlled, double-blinded cross-over trial

Chlorogenic acids (CGA) are one of the most common substances in coffee beans. CGA was a huge fad back in 2012 when Dr Oz featured Green Coffee Beans on his show for their supposed weight loss benefits.

He actually carried out a study with 100 women from his studio audience, with half getting a placebo and half taking 500mg of Green Coffee Bean Extract a day for 6 weeks. Those receiving the CGA did in fact lose twice as much weight as those who did not.

He was a bit over exuberant, proclaiming:

It was kind of the “last straw”, since he had been pumping many other supposed “miracle” weight loss pills for years, often with dubious results. Raspberry Ketones, African Mango, Safflower oil are just a few.

After getting hauled in front of congress to explain himself, Dr Oz has since backed WAY off and stayed away from weight loss pills of any kind.

As a result, Green Coffee Beans got tarred with the same scam label that the previous products had by then earned, even though the CGA in Green Coffee Beans did in fact have evidence they actually aid in weight loss, even if Dr Oz was a little carried away.

Well, this most recent study weighs in with more evidence that CGA does actually work to increase fat-burning. So, more about that below. The study was published here:

Coffee is one of the most widely consumed beverages throughout the world, and its origin dates back to the fifteenth century or earlier(1). Epidemiological studies have identified coffee consumption as a factor associated with reduced risks of type 2 diabetes(2,3), liver cirrhosis(4), Alzheimer’s disease(5) and Parkinson’s disease(6). The coffee bean, and especially the green coffee bean, is known to be a rich source of biologically active compounds such as polyphenolic antioxidants including 5-caffeoylquinic acid (5-CQA) (formerly called 3-CQA or chlorogenic acid (CGA))(7), 3-CQA, 4-CQA, 3,4-dicaffeoylquinic acid (3,4-diCQA), 3,5-diCQA, 4,5-diCQA, 3-feruloylquinic acid (3-FQA), 4-FQA, and 5-FQA, which consist of CGA(8,9).

Recent human studies have shown that daily consumption of 340–600 mg/d of CGA (equivalent to one–two cups of coffee(10)) induced favourable effects on fat oxidation(11) and lowered postprandial glucose(12) and insulin resistance(13) as well as had favourable effects on endothelial functions(14,15) and mood enhancement(16). Accumulating evidence has suggested that CGA exhibit many biological properties including antioxidant(17), antiobesity(18), hypoglycaemic and hypolipidaemic effects(19).

Moreover, a recent study demonstrated that CGA exerts anti-amnesic activity via inhibition of acetylcholinesterase and malondialdehyde in the hippocampus and frontal cortex(20).

Foods and associated bioactive substances often affect multiple physiological functions, as exemplified by caffeine acting on the autonomic nervous system(21), energy metabolism(22,23) and sleep(24). Cross-talk between physiological functions exists within the body, and several lines of evidence suggest a link between sleep, the autonomic nervous system and energy metabolism(25). Neurosubstances such as orexin, leptin and melatonin act on sleep and

2 I. Park et al.
wakefulness and on energy balance(26–28). The effects of CGA ingestion on carbohydrate and fat metabolism warrant additional studies evaluating the effects of CGA ingestion on sleep, the lack of which has been identified as a risk factor for, amongst other conditions, obesity, hypertension and type 2 diabetes(29–31). Metabolites of CGA potentiated pentobarbital-induced sleep by prolonging sleeping time and shortening sleep latency(32), but the effects of consuming CGA on human sleep have not been studied.
The present study evaluated the effects of ingesting 600 mg of CGA on sleep architecture, energy metabolism and autonomic nervous function in healthy male and female subjects. Simultaneous measurements of sleep architecture and respiratory analysis could provide new insights regarding which CGA exert possible sleep and energy metabolism improvements. To evaluate energy metabolism during sleep, whole-room indirect calorimetry was adopted, which provides a controlled environment in which energy metabolism can be continuously measured for a long period, including during sleep.
Methods
Subjects

In all, four healthy male subjects and five healthy female subjects with a mean age of 25·7 years and BMI of 21·8kg/m2 participated in this study. Subjects had normal sleeping profiles based on the Pittsburgh sleep quality index (≤5). No subject had engaged in regular exercise more than twice a week or used any regular or temporary medication. Exclusion criteria for the subjects were a clinical diagnosis of sleep apnoea hypopnea syndrome, a medical or psychiatric condition, smokers and shift workers. Subjects who drank more than a bottle of alcohol (350 ml) per day were also excluded from the study. For female subjects, those with a severe menstrual cycle problem and those who were pregnant were excluded. One female subject was excluded from the statistical analysis of energy metabolism because of mechanical trouble (unstable flow control of the metabolic chamber) during the trial with CGA. This study was conducted according to the guidelines laid down in the Declaration of Helsinki and all procedures involving human subjects were approved by the Ethics Committee of the University of Tsukuba. All subjects provided written informed consent before study commencement; the protocol was registered with Clinical Trials UMIN, ID no.: UMIN000022889.
Protocol
The present study was a placebo-controlled, double-blinded, cross-over intervention study. During each 5-d session, a test beverage containing 0 (control (CON)) or 600 mg of CGA was consumed 10 min before bedtime and subjects were asked to refrain from ingesting beverages containing caffeine and alcohol. During the study, the subjects maintained their usual activities and dietary habits, which were confirmed by actigraphy recording and a daily diary. On days 3–5, the subjects ingested specified meals for breakfast, lunch and dinner, which were provided by the study coordinators.
On the 5th day, subjects consumed lunch in the laboratory and stayed indoors. After consuming dinner, subjects entered the whole-room metabolic chamber and remained sedentary. Subjects went to bed at their usual bedtime and slept for 8 h. Energy metabolism was measured for 16 h (from 3 h before bedtime on the 5th day to 5 h after waking the next morning).

The meals provided in the laboratory were based on energy requirements estimated from the BMR equation(33) with a physical activity level of 1·3. The meal composition (energy percentage (E%)) was 15 E% protein, 25 E% fat and 60 E% carbohydrates, and both groups received meals identical in quantity and composition. The energetic distribution was 30 E% for breakfast, 30 E% for lunch and 40 E% for dinner.
The experiment was preceded by an adaptation night in the metabolic chamber, during which the sensors and electrodes of the polysomnographic recording system were attached to the subjects. The two trials were separated by a washout period of 2–4 weeks, and studies with female subjects were performed during the same phase of the menstrual cycle; three female subjects were evaluated during the follicular phase and the other two female subjects were evaluated during the luteal phase.

Beverages
The CGA and placebo test beverages were prepared to be indistinguishable on the basis of appearance and flavour, and were canned (100 ml). All CGA isomers are presented according to the IUPAC nomenclature(9). The test beverage contained 0 or 600 mg of CGA, which consisted of CQA (68%), FQA (14%) and diCQA (19%) (Table 1). CGA were prepared from green coffee beans using hot water extraction followed by spray drying and girding. After activated carbon filtration, caffeine was not detected (<0·5 mM). The CGA composition in test beverages was measured by HPLC with a UV detector (325nm). All peaks of the isomers were confirmed by LC-MS(34). The standard, 5-CQA, was purchased from Sigma, and other standards, 3-CQA, 4-CQA, 3-FQA, 4-FQA, 5-FQA, 3,4-diCQA, diCQA and 3,5-diCQA, were obtained by repeated fractionations of green coffee bean extract (purity >96%, confirmed by LC-UV detection and 1H-NMR) using preparative chromatography with an octa decyl silyl (ODS) column(34). Both beverages were caffeine-free, and the energy contents were 29 kJ/100 ml (7 kcal/100 ml) and 8 kJ/100 ml (2 kcal/100 ml) in the CGA and placebo beverages, respectively.
Table 1. Chlorogenic acid (CGA) compositions of the test beverages (mg/100 ml)

Sleep recording
The recording system consisted of four electroencephalography derivations (C3-A2, C4-A1, O2-A1, and O1-A2), submental electromyography and bilateral electro-oculography using a PSG-1100 (Nihon Kohden). Sleep parameters were classified in 30-s intervals as wakefulness and stage 1, stage 2, slow-wave sleep (SWS), and rapid eye movement (REM) sleep according to the method developed by Rechtschaffen & Kales(35). In addition, total sleep time, sleep onset latency, REM sleep latency and sleep efficiency percentages were measured.
Data analysis: spectral analysis of the electroencephalogram
The C3-A2 electroencephalogram (EEG) recording was analysed using discrete fast Fourier transform techniques. The fast Fourier transform was conducted on an EEG record length of 5 s to obtain a frequency resolution of 0·2 Hz. Each 5-s segment of the EEG signal was first windowed with a Hanning tapering window before computing the power spectra. The spectral distribution was categorised into the following frequency bands: delta (0·75–4·00 Hz), theta (4·10–8·00 Hz), alpha (8·10–12·00 Hz), sigma (12·10–14·00 Hz) and beta (14·10– 30·00 Hz). The power content of the delta band for each 30-s epoch of sleep was determined as the average power across the six 5-s segments of the EEG (expressed as μV2)(36).
Indirect calorimetry
The airtight metabolic chamber measures 2·00×3·45×2·10m (FHC-15S; Fuji Medical Science Co., Ltd), and was used from day 5, 4 h before bedtime, to day 6, 5 h after waking (total, 16 h). Air in the chamber is pumped out at a rate of 80 litres/min. The temperature and relative humidity of incoming fresh air were controlled at 25°C and 55%, respectively. The chamber was furnished with an adjustable hospital bed, desk, chair and toilet. Concentrations of O2 and carbon dioxide (CO2) in outgoing air were measured with high precision by online process MS (VG Prima δB; Thermo Electron Co.). The precision of MS, defined as the standard deviation for continuous measurement of the calibrated gas mixture (O2, 15 %; CO2, 5 %), was 0·0016 % for O2 and 0·0011 % for CO2. Every minute, VO2 and CO2 production (VCO2) rates were calculated using an algorithm for improved transient response(37). Oxidation of macronutrients and energy expenditure were calculated from VO2, VCO2 and urinary N excretion(38). Rates of N, an index of protein oxidation, were assumed to be constant during calorimetry:

Once the rates of glucose, fat and protein oxidation had been computed, the total rate of energy production could be estimated by taking energetic equivalents of the three substrates into account. Conversion factors for energetic equivalents were 17·15 kJ/g (4·10 kcal/g) for protein (107·215 kJ/g (25·625 kcal/g) for urinary N), 15·65kJ/g (3·74kcal/g) for carbohydrates and 39·75 kJ/g (9·50 kcal/g) for fat(38).
Autonomic nervous system activity
The R-R intervals of the electrocardiogram were continuously monitored using a telemetric heart-rate monitor (LX−3230, 207; Fukuda Denshi Co., Ltd) and the power spectrum of heart-rate variability was estimated using the maximum entropy method. The spectra measured were computed as amplitudes (i.e. areas under the power spectra) and are presented in ms2. Parasympathetic and sympathetic nervous system activities were estimated at a high frequency (HF; 0·15−0·4Hz) and as the power ratio of low frequency (LF; 0·04 − 0·15 Hz):high frequency (LF:HF), respectively(39).
Statistical analysis
Results are expressed as means with their standard errors. Sample size was calculated on the basis of a power analysis using previous data. A study group of nine subjects was required for a power of 80% at a two-sided α of 0·05. We performed a power analysis; the actual power was >80% for each comparison. Paired t tests were used to compare values of energy metabolism, sleep parameters and autonomic nervous system activity between the groups. The effects of CGA on the time course of autonomic nervous system activity were assessed by a two-way repeated measures ANOVA and a Bonferroni multiple comparison. Differences were considered significant when the error probability was <0·05.
Results
Body weight, BMI and body fat did not change during the 5-d trial with control and CGA beverages (Table 2). Sleep architecture (lengths of stage 1, stage 2, SWS, REM and wakefulness after sleep onset) was similar between the trials, except that sleep latency was shorter in trials with ingestion of CGA (Table 3). The time course of delta power, a quantitative index of SWS, was similar between the two trials, but those during the 1st hour of sleep during CGA trials tended to be higher than those during CON trials. A two-factor repeated measures ANOVA identified a significant interaction effect. The average delta power during the 1st hour (CON: 29 165 (SEM 5711) μV2 v. CGA: 40758 (SEM 5128)μV2, P=0·08) seemed to be higher in the CGA trials than in the CON trials, but no statistically significant difference was found in multiple comparisons (Fig. 1).
The average sympathetic nervous system activity during 16h of calorimetry was similar (CON: 2·20 (SEM 0·09) v. CGA: 2·36 (SEM 0·16)), but parasympathetic nervous system activity was enhanced by CGA consumption (CON: 919 (SEM 55) ms2 v. CGA: 999 (SEM 78) ms2, P < 0·05). Visual inspection of the time course of autonomic nervous system activity suggests that parasympathetic activity and sympathetic activity increased during the second half

Discussion
In the present study, we assessed whether ingestion of beverages containing CGA for over 5 d had any effect on sleep, autonomic nervous system activity or energy metabolism in healthy humans. Our findings revealed that CGA shortened sleep latency as opposed to the controls, whereas no effect on sleep architecture such as SWS, REM or waking after sleep onset was observed.

Indirect calorimetry revealed that consumption of CGA increased fat oxidation but did not affect energy expenditure during sleep. Consumption of CGA enhanced parasympathetic activity, which was assessed on the basis of heart-rate variability. These results support the possibility that beverages containing CGA possess beneficial effects to prevent obesity and improve sleep.

Fat oxidation during sleep was increased by consumption of CGA. An animal experiment reported an inhibitory effect of the green coffee bean extract, which is rich in CGA and its related compounds, on visceral fat accumulation and body weight gain in mice. CGA and its related compounds up-regulated carnitine palmitoyltransferase activity in the liver(40).

Using continuous and prolonged indirect calorimetry, the present study confirmed the findings of a previous report on use of indirect calorimetry for a short duration (3·5h), which showed increased fat oxidation after ingestion of CGA (359mg)(41). These indirect calorimetry findings are consistent with another human study reporting that daily consumption of coffee enriched with CGA for 12 weeks resulted in body weight reduction(42).

The effect of CGA in stimulating fat oxidation during sleep was manifested without an adverse effect on sleep architecture, which is in contrast with the effects of sympathomimetics such as capsaicin, catechins and caffeine.

Capsaicin, in addition to stimulating epinephrine secretion, acts as a transient receptor potential cation channel subfamily V member 1 agonist(43) and disturbs sleep via changes in body temperature. Caffeine, in addition to inhibiting the phosphodiesterase-induced degradation of intracellular cyclic AMP, acts as an adenosine A2A receptor antagonist and increases wakefulness(44).

Effects of catechins, which inhibit norepinephrine degradation, on sleep remain to be evaluated. A potential mediator of CGA that can shorten sleep latency is ferulic acid, which is a metabolite of CGA; ferulic acid also potentiates pentobarbital-induced sleep in mice by prolonging sleeping time and shortening sleep latency in a dosedependent manner(32). At 1-2h after the oral ingestion of CGA, they are metabolised via methylation and appear as ferulic acids in plasma(34,45).

Contrary to the present human study, sleep latency in rats was significantly increased by ingestion of CGA (CGA, 500 mg/kg and caffeic acid, 200 mg/kg)(46).

The dose of CGA in the animal experiment was several orders of magnitude greater than that in the present human study. Human subjects, as opposed to experimental animals, were exposed to CGA via daily consumption of coffee and vegetables.

The function of the autonomic nervous system was also affected by ingestion of CGA through up-regulation of parasympathetic nervous system activity and a decrease in heart rate. An increase in parasympathetic nervous system activity may explain the antihypertensive effects of CGA, for which several mechanisms have been proposed: reduction of free radical production, scavenging free radicals, stimulation of NO production and inhibition of angiotensin-converting enzyme(47).

In addition to vasodilation effects in peripheral tissue, NO acts as a neuromodulator within the central and peripheral nervous systems, and modulates sympathetic and parasympathetic activities(48). Close inspection of the time courses of sympathetic nervous system activity revealed the following. First, before and during the first 3 h of sleep, activities of the sympathetic and parasympathetic nervous systems were similar between the trials.

The mechanism by which ingestion of CGA shortened sleep latency cannot be explained by the effect of chlorogenic ingestion on autonomic nervous system activity. Second, relative to that in the placebo-control trial, parasympathetic activity was higher during the second half of sleep, whereas sympathetic activity was higher after awakening in the morning in trials with ingestion of CGA.

Thus, ingestion of CGA induced a greater decrease in parasympathetic activity and increase in sympathetic activity after awakening.

In conclusion, ingestion of CGA stimulated fat oxidation without an adverse effect on sleep architecture; rather, it shortened sleep latency. Ingestion of CGA increased parasympathetic activity during sleep, and the causal relation to its effects on sleep and fat oxidation remains to be evaluated. To generalise the present findings, an experiment with a larger sample size of obese and/or aged subjects should be performed.

References
1. D’Amicis A & Viani R (1993) The consumption of coffee. In Caffeine, Coffee and Health, pp. 1–16 [S Garattini, editor]. New York: Raven Press, Ltd.
2. Greenberg JA, Boozer CN & Geliebter A (2006) Coffee, diabetes and weight control. Am J Clin Nutr 84, 682–693.
3. Van Dam RM & Feskens EJ (2002) Coffee consumption and risk of type 2 diabetes mellitus. Lancet 360, 1477–1478.
4. Tverdal A & Skurtveit S (2003) Coffee intake and mortality
from liver cirrhosis. Ann Epidemiol 13, 419–423.
5. Eskelinen MH, Ngandu T, Tuomilehto J, et al. (2009) Midlife coffee and tea drinking and the risk of late-life dementia: a population-based CAIDE study. J Alzheimers Dis
16, 85–91.
6. Hernán MA, Takkouche B, Caamaño-Isorna F, et al. (2002)
A meta-analysis of coffee drinking, cigarette smoking, and the
risk of Parkinson’s disease. Ann Neurol 52, 276–284.
7. Stalmach A, Steiling H, Williamson G, et al. (2010) Bioavailability of chlorogenic acids following acute ingestion of coffee by humans with an ileostomy. Arch Biochem
Biophys 501, 98–105.
8. Clifford MN & Wight J (1976) The measurement of feru-
loylquinic acids and caffeoylquinic acids in coffee beans. Development of the technique and its preliminary application to green coffee beans. J Sci Food Agric 27, 73–84.
Chlorogenic acids and sleeping metabolism 5
Downloaded from https:/www.cambridge.org/core. Queen Mary, University of London, on 20 Apr 2017 at 04:16:57, subject to the Cambridge Core terms of use, available at https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S0007114517000587
6 I. Park et al.
9. Anonymous (1976) IUPAC Commission on the Nomenclature of Organic Chemistry (CNOC) and IUPAC-IUB Commission on Biochemical Nomenclature (CBN). Nomenclature of cyclitols. Recommendations, 1973. Biochem J 153, 23–31.
10. Fukushima Y, Ohie T, Yonekawa Y, et al. (2009) Coffee and green tea as a large source of antioxidant polyphenols in the Japanese population. J Agric Food Chem 57, 1253–1259.
11. Soga S, Ota N & Shimotoyodome A (2013) Stimulation of postprandial fat utilization in healthy humans by daily consumption of chlorogenic acids. Biosci Biotechnol Biochem 77, 1633–1636.
12. Jokura H, Watanabe I, Umeda M, et al. (2015) Coffee polyphenol consumption improves postprandial hyperglycemia associated with impaired vascular endothelial function in healthy male adults. Nutr Res 35, 873–881.
13. Lecoultre V, Carrel G, Egli L, et al. (2014) Coffee consumption attenuates short-term fructose-induced liver insulin resistance in healthy men. Am J Clin Nutr 99, 268–275.
14. Ochiai R, Sugiura Y, Otsuka K, et al. (2015) Coffee bean polyphenols ameliorate postprandial endothelial dysfunction in healthy male adults. Int J Food Sci Nutr 66, 350–354.
15. Ochiai R, Sugiura Y, Shioya Y, et al. (2014) Coffee polyphenols improve peripheral endothelial function after glucose loading in healthy male adults. Nutr Res 34, 155–159.
16. Camfield DA, Silber BY, Scholey AB, et al. (2013) A randomised placebo-controlled trial to differentiate the acute cognitive and mood effects of chlorogenic acid from decaffeinated coffee. PLOS ONE 8, e82897.
17. Kono Y, Kobayashi K, Tagawa S, et al. (1997) Antioxidant activity of polyphenolics in diets. Rate constants of reactions of chlorogenic acid and caffeic acid with reactive species of oxygen and nitrogen. Biochim Biophys Acta 1335, 335–342.
18. Cho AS, Jeon SM, Kim MJ, et al. (2010) Chlorogenic acid exhibits anti-obesity property and improves lipid metabolism in high-fat diet-induced-obese mice. Food Chem Toxicol 48, 937–943.
19. Meng S, Cao J, Feng Q, et al. (2013) Roles of chlorogenic acid on regulating glucose and lipids metabolism: a review. Evid Based Complement Alternat Med 2013, 801457.
20. Kwon SH, Lee HK, Kim JA, et al. (2010) Neuroprotective effects of chlorogenic acid on scopolamine-induced amnesia via anti-acetylcholinesterase and anti-oxidative activities in mice. Eur J Pharmacol 649, 210–217.
21. Porciúncula LO, Sallaberry C, Mioranzza S, et al. (2013) The Janus face of caffeine. Neurochem Int 63, 594–609.
22. Arciero PJ, Gardner AW, Calles-Escandon J, et al. (1995) Effects of caffeine ingestion on NE kinetics, fat oxidation, and energy expenditure in younger and older men. Am J Physiol 268, E1192–E1198.
23. Bracco D, Ferrarra JM, Arnaud MJ, et al. (1995) Effects of caffeine on energy metabolism, heart rate, and methylxanthine metabolism in lean and obese women. Am J Physiol 269, E671–E678.
24. Júdice PB, Magalhães JP, Santos DA, et al. (2013) A moderate dose of caffeine ingestion does not change energy expenditure but decreases sleep time in physically active males: a double-blind randomized controlled trial. Appl Physiol Nutr Metab 38, 49–56.
25. Hirotsu C, Tufik S & Andersen ML (2015) Interactions between sleep, stress, and metabolism: from physiological to pathological conditions. Sleep Sci 8, 143–152.
26. Nicolaidis S (2006) Metabolic mechanism of wakefulness (and hunger) and sleep (and satiety): role of adenosine triphosphate and hypocretin and other peptides. Metabolism 55, S24–S29.
27. Cipolla-Neto J, Amaral FG & Afeche SC (2014) Melatonin, energy metabolism and obesity: a review. J Pineal Res 56, 371–381.
28. Sakurai T (2005) Roles of orexin/hypocretin in regulation of sleep/wakefulness and energy balance. Sleep Med Rev 9, 231–241.
29. Patel SR & Hu FB (2008) Short sleep duration and weight gain: a systematic review. Obesity (Silver Spring) 16, 643–653.
30. Cappuccio FP, Taggart FM, Kandala NB, et al. (2008) Meta-analysis of short sleep duration and obesity in children and adults. Sleep 31, 619–626.
31. Nielsen LS, Danielsen KV & Sørensen TI (2011) Short sleep duration as a possible cause of obesity: critical analysis of the epidemiological evidence. Obes Rev 12, 78–92.
32. Tu Y, Cheng SX, Sun HT, et al. (2012) Ferulic acid potentiates pentobarbital-induced sleep via the serotonergic system. Neurosci Lett 525, 95–99.
33. Anon. (2010) Dietary Reference Intakes for Japanese. Tokyo: Ministry of Health Labour and Welfare of Japan.
34. Matsui Y, Nakamura S, Kondou N, et al. (2007) Liquid chromatography-electrospray ionization-tandem mass spectrometry for simultaneous analysis of chlorogenic acids and their metabolites in human plasma. J Chromatogr B Analyt Technol Biomed Life Sci 858, 96–105.
35. Rechtschaffen A & Kales A (1968) A Manual of Standardized Terminology, Techniques and Scoring System for Sleep Stages of Human Subjects. Washington, DC: US Government Printing Office.
36. Zhang L, Samet J, Caffo B, et al. (2008) Power spectral analysis of EEG activity during sleep in cigarette smokers. Chest 133, 427–432.
37. Tokuyama K, Ogata H, Katayose Y, et al. (2009) Algorithm for transient response of whole body indirect calorimeter: deconvolution with a regularization parameter. J Appl Physiol (1985) 106, 640–650.
38. Ferrannini E (1988) The theoretical bases of indirect calorimetry: a review. Metabolism 37, 287–301.
39. Stein PK & Kleiger RE (1999) Insights from the study of heart rate variability. Annu Rev Med 50, 249–261.
40. Shimoda H, Seki E & Aitani M (2006) Inhibitory effect of green coffee bean extract on fat accumulation and bodyweight gain in mice. BMC Complement Altern Med 6, 9.
41. Noriyasu O, Satoko S, Takatoshi M, et al. (2010) Consumption of coffee polyphenols increases fat utilization in humans. J Health Sci 56, 745–751.
42. Thom E (2007) The effect of chlorogenic acid enriched coffee on glucose absorption in healthy volunteers and its effect on body mass when used long-term in overweight and obese people. J Int Med Res 35, 900–908.
43. Edwards SJ, Montgomery IM, Colquhoun EQ, et al. (1992) Spicy meal disturbs sleep: an effect of thermoregulation? Int J Psychophysiol 13, 97–100.
44. Huang ZL, Qu WM, Eguchi N, et al. (2005) Adenosine A2A, but not A1, receptors mediate the arousal effect of caffeine. Nat Neurosci 8, 858–859.
45. Renouf M, Guy PA, Marmet C, et al. (2010) Measurement of caffeic and ferulic acid equivalents in plasma after coffee consumption: small intestine and colon are key sites for coffee metabolism. Mol Nutr Food Res 54, 760–766.
46. Shinomiya K, Omichi J, Ohnishi R, et al. (2004) Effects of chlorogenic acid and its metabolites on the sleep-wakefulness cycle in rats. Eur J Pharmacol 504, 185–189.
47. Zhao Y, Wang J, Ballevre O, et al. (2012) Antihypertensive effects and mechanisms of chlorogenic acids. Hypertens Res 35, 370–374.
48. Zanzinger J (1999) Role of nitric oxide in the neural control of cardiovascular function. Cardiovasc Res 43, 639–649.

Mitochondrial transplantation: From animal models to clinical use in humans

1. Introduction
The importance of the mitochondrion in the maintenance and preservation of cellular homeostasis and function is well established and there is a sufficient body of evidence to show that mitochondrial injury or loss of function is deleterious (Durhuus et al., 2015). The mechanisms leading to mitochondrial dysfunction are varied and include genetic changes occurring at the nuclear or the mitochondrial genome, environmental insult or alterations in homeosis. In all cases, the end result of mitochondrial dysfunction is cellular dysfunction that can limit or severely modulate organ function and ultimately increase morbidity and mortality.

In our research, we have focused on the myocardium, a highly aerobic organ in which mitochondria comprise 30% of cellular volume (Faulk et al., 1995; Faulk et al., 1995a; Toyoda et al., 2000; Toyoda et al., 2001; McCully et al., 2003). The mitochondria supply the energy requirements of the myocardium. This energy is derived through oxidative phosphorylation in the myocardium and is dependent upon the coronary circulation. Under equilibrium conditions the mitochondria within the heart extract greater than 79% of arterial oxygen from the coronary arteries (Fillmore et al., 2013). As heart rate increases or if myocardial workload is increased the oxygen demand is increased and is dependent upon increased coronary flow. Thus, any interruption or impedance in coronary blood flow will significantly limit oxygen delivery to the heart and significantly decrease function and hemostasis (Akhmedov et al., 2015; Doenst et al., 2013; Kolwicz et al., 2013). It is generally accepted that the cessation of coronary blood flow, and thus oxygen delivery, is the initial step in the process leading to myocardial ischemic injury. The sequence of events and the mechanisms associated with this injury are many and are reviewed elsewhere (Lesnefsky et al., 2003; Kalogeris et al., 2012; Ong et al., 2015 Kalogeris et al., 2016 ; Lesnefsky et al., 2017). The end result of ischemia is loss of high energy synthesis and the depletion of high energy stores such that the heart is unable to support hemostasis and maintain function (Rosca et al., 2013 ) .

This reduction of high energy synthesis and stores is rapid. 31Pnuclear magnetic resonance studies have shown that following regional or global ischemia wherein the blood flow to the heart is temporarily ceased, high energy phosphate synthesis and stores are rapidly decreased within 6 minutes and that this decrease continues for at least 60 180 minutes after the restoration of blood flow and is associated with significantly decreased myocardial cellular viability and myocardial function (Tsukube et al., 1997).

Mitochondrial modulations induced by ischemia in the myocardium are many. We and others have demonstrated that following ischemia there are changes in mitochondrial morphology and structure (Rousou et al., 2004; Lesnefsky et al., 2004; McCully et al., 2007). Transmission electron microscopy and lightscattering spectrophotometry have shown that ischemia significantly increases mitochondrial matrix and cristae area and mitochondrial matrix volume (McCully et al., 2007). In addition, there is a decrease in mitochondrial complex activity, cytochrome oxidase I Vmax and a decrease in oxygen consumption and an increase in mitochondrial calcium accumulation (Faulk et al.,1995a).

These changes occur in concert with changes in mitochondrial transcriptomics, with downregulation of annotation clusters for mitochondrion function and energy production and the downregulation of cofactor catabolism, generation of precursor metabolites of energy, cellular carbohydrate metabolism, regulation of biosynthesis, regulation of transcription, and mitochondrial structure and function (enrichment score >2.0, P<.05) ( Black et al., 2012; Masuzawa et al., 2013). In addition, there are changes evident in overall protein synthesis. Proteomic analysis has shown that ischemia significantly alters mitochondrial proteins involved in fatty acid and glucose metabolism, ATP biosynthesis, and oxidoreductase activity (fold change >1.4, P < .05) ( Black et al., 2012; Masuzawa et al., 2013). All these changes are associated with decreased myocardial cellular viability and decreased myocardial function and suggest that the mitochondrion plays a key role in myocardial viability and function following ischemia and repercussion. In total, these data have provided a basis for continued mitochondrial associated investigations into the rescue and preservation of myocardial tissue and myocardial function (Suleiman et al., 2001). The methodologies for these investigations have been many and varied. In general, the approach to cardioprotection has been either associative or indirect with emphasis on a single mechanistic route or complex or the use of an additive or inhibitor, used either as a single therapy or in combination with others. These include, but are not limited to, the use of pharmaceuticals either before or after ischemia, such as antioxidants, the use of calcium channel antagonists, adenosine, adenosine deaminase inhibitors, adenosine transport inhibitors, or a combination of both , adenosine receptor agonists, mitochondrial ATPsensitive potassium channel openers, phosphodiesterase inhibitors, 5' AMPactivated protein kinase activators, metabolic modulators, antiinflammatory agents and procedural approaches including, preischemia, postischemia and remote ischemic preconditioning (Hsiao et al., 2015 ; Madonna et al., 2015; Hausenloy et al., 2016; Laskowski et al., 2016; OrenesPiñero et al., 2015). In some methodologies, therapeutic intervention is required days or months prior to the ischemic event. Unfortunately, clinical trials using these approaches, either alone or in combination, have for the most part been unsuccessful. 2. Mitochondrial transplantation
We rationalized that the therapeutic approach to cardioprotection should be comprehensive and rather than involving a single or multiple mechanistic pathways, intervention should be specific. To this end, we speculated that the replacement or augmentation of mitochondria damaged during ischemia and reperfusion should be the target for therapeutic intervention. We hypothesized that viable mitochondria isolated form the patient’s own body, from a nonischemic area, and then delivered by direct injection into the ischemic organ would replace or augment damaged mitochondria; thus, allowing for the rescue of myocardial cells and restoration of myocardial function. We have termed this therapeutic intervention; mitochondrial transplantation (McCully et al., 2009; Masuzawa et al., 2013; Cowan et al., 2016; Kaza et al., 2016).
2.1 Mitochondrial isolation

Mitochondrial transplantation is based on the delivery of isolated, viable mitochondria to the target organ. The isolation of mitochondria can be performed using a variety of techniques and methodologies. In our initial studies, we used a standard procedure requiring consecutive low and high speed centrifugation to isolate purified mitochondria. This procedure required approximately 90120 minutes to complete. The repetitive centrifugation steps increases the time for mitochondrial isolation and ultimately reduce mitochondrial viability (Graham 2001; Frezza et al., 2007; Pallotti and Lenaz 2007; Wieckowski et al., 2009; FernándezVizarra et al., 2010; Schmitt S, et al., 2013).

In cardiac surgery, and in many other surgical interventions, the interventional time is 4560 minutes and therefore mitochondrial isolation times of 90120 minutes are inappropriate for clinical usage. Mitochondrial isolation time must be short and efficient so that the therapeutic use of mitochondrial transplantation would not extend the surgical time and possibly add to patient morbidity or mortality. To meet the demands and requirements for clinical application, we have developed a rapid methodology for the isolation of autologous mitochondria (Preble et al., 2014; Preble et al., 2014a).

Firstly, two small pieces of autologous tissue are obtained from the patient’s own body during the surgical procedure. The tissue is dissected out using a #6 biopsy punch. The amount of tissue is less than 0.1 gram. The source of tissue is dependent upon the surgical entry point and access. The only requirement being that the tissue source must be free from ischemia and be viable.

In our studies, we have used viable, nonischemic skeletal muscle tissue as a source for isolated mitochondria. The muscle tissue was obtained from the pectoralis major or the rectus abdominis based on standardized minithoracotomy or sternotomy, respectively. Other tissue sources can also be used and we have used liver tissue with excellent results. The tissue, once obtained is immediately used for mitochondria isolation.

The methodology for the isolation of mitochondria for use in mitochondrial transplantation is simple and rapid and can be performed in under 30 minutes. The freshly isolated tissue is homogenized using a commercial automated homogenizer. For our uses we have used the Miletenyi gentleMACS Dissociator (Miltenyi Biotec Inc., San Diego, CA).

This homogenizer was chosen over the more standardized PotterElvehjem homogenizer (glass with Teflon pestle) or bead based homogenizers as it provides a sterilized, disposable unit for homogenization with fixed plastic wings for homogenization and an automated programable homogenization protocol allowing for uniform and consistent homogenization of tissue that is not easily achieved with manual homogenization methods.

The other systems require cleaning and sterilization for each usage and allow for variance in homogenization based on the operator. Bead homogenization systems were not considered due to the possibility of contamination of the mitochondria by bead fragments. Once the tissue is obtained homogenization can be performed in 90120 seconds.

The homogenized tissue is then subjected to brief digestion (10 minutes on ice) with subtilisin A (Protease from Bacillus licheniformis, Type VIII, Sigma, Aldrich, St. Louis, MO) and the digested homogenate filtered through a series of disposable sterile mesh filters. The filtration can all be performed in 23 minutes.

The mitochondria can then be used for direct application or can be concentrated by centrifugation (9000 rpm at 4 oC for 10 minutes). The mitochondrial yield using this methodology is approximately 1 x 109 to 1 x 1010 mitochondria, using the two biopsy tissue samples (< 0.1 g) and provides sufficient mitochondria for quality assurance and quality control assessment ( Preble et al., 2014a). The isolated mitochondria are of the correct size and shape as assessed by electron microscopy and have normal cristae and membranes and show no damage or injury. The isolated mitochondria are pure and have no detectable cytosolic, nuclear or microsomal components. Functional analysis of isolated mitochondria shows that the isolated mitochondria maintain membrane potential and viability and that oxygen consumption and respiratory control index for malateinduced complex I and succinateinduced complex II are equal to that of mitochondria isolated by other methodologies (Rousou et al., 2004; McCully et al., 2009). Once isolated, the mitochondria are immediately used for mitochondrial transplantation. We have found that the isolated mitochondria can be stored on ice for approximately 1 hour but storage beyond this time point greatly reduces efficacy. This is in agreement with previous reports that have shown that mitochondrial bioenergetic function is decreased to <10–15% of normal after the mitochondria were frozen, even when preservatives are used (Wechsler, 1961; Olson et al., 1967). In all our studies, we have used total mitochondria for mitochondrial transplantation. The bioenergetic function of this population includes that of subsarcolemmal and intrafibrillar mitochondria. Previous studies have shown that these mitochondrial subpopulations have differing oxygen consumption and metabolism (Riva et al., 2005; Chen et al., 2008; Kurian et al., 2012). In our studies, we have examined the cardioprotective efficacy of intrafibrillar, subsarcolemmal and total mitochondria. We have found that total mitochondria provide for cardioprotection and that no added cardioprotection is provided using either subsarcolemmal or interfibrillar mitochondrial subpopulations (McCully et al., 2009). It is important that the isolated mitochondria be intact and viable. The use of dead, nonviable mitochondria, mitochondrial proteins or complexes, mitochondrial DNA/RNA or high energy phosphates alone or in combination do not provide cardioprotection (McCully et al., 2009). It has been previously demonstrated that exogenous ATP supplementation and/or ATP synthesis promoters do not restore highenergy phosphate stores and have no beneficial effects on postischemic functional recovery in the heart (McCully et al., 2009). Following determination of mitochondrial number and viability the isolated mitochondria are suspended in 1 ml of respiration buffer containing 250 mmol/l sucrose, 2 mmol/l KH2PO4, 10 mmol/l MgCl2, 20 mmol/l K+HEPES buffer, pH 7.2, 0.5 mmol/l K+EGTA, pH 8.0, 5 mmol/l glutamate, 5 mmol/l malate, 8 mmol/l succinate and 1 mmol/l ADP. Quality control and assurance parameters have been previously described by us (Preble et al., 2014). The isolated mitochondria are then directly injected into the ischemic zone of the heart just prior to reperfusion using a 1 mL tuberculin syringe with a 28or 32gauge needle. The injection volumes are 0.1 mL and contain approximately 1 x 107 mitochondria at each injection site. This volume is optimal and allows for mitochondrial uptake within the myocardium with no backflow leakage of the injected mitochondria. In our studies, we have found that 810 individual injections are sufficient to cover the areaat–risk, although the absolute number of injection sites can be increased. 2.2 Mitochondrial delivery
The direct injection of mitochondria is simple and allows for focal concentration of the injected mitochondria. In our studies the number of mitochondria used for direct injection is 13 x 107 mitochondria. The mitochondria are suspended in 1 mL respiration buffer and injected at 810 sites within the area at risk using a 1 mL tuberculin syringe with a 2832 gage needle (McCully et al., 2009; Masuzawa et al., 2013; Cowan et al., 2016; Kaza et al., 2016). Mitochondrial concentrations > 2 x 108 are not fully suspended in 1 mL of respiration buffer and are therefore not advised for use for mitochondrial transplantation by direct injection.

Fluorescence microscopy has demonstrated that transplanted mitochondria delivered by direct injection are present and viable for at least 28 days following injection into the myocardium, the end point of our animal experiments (Masuzawa et al., 2013, Kaza et al., 2016).

The transplanted mitochondria are widely distributed from the epicardium to the subendocardium >2–3 mm from the injection site (McCully et al., 2009; Masuzawa et al., 2013). The majority of injected mitochondria are found initially within the interstitial spaces between cardiomyocytes. Within 1 hour postdelivery, the transplanted mitochondria are detectable within cardiomyocytes residing near the sarcolemma between Zlines of the sarcomeres and in clusters around endogenous damaged mitochondria as well as near the nucleus. Enumeration of injected mitochondria has shown that 43.52% ± 4.46 (mean ± SEM) of the injected mitochondria are attached to or found within cardiomyocytes (Cowan et al., 2016).

We have speculated that the mechanisms through which the transplanted mitochondria distribute within the myocardium following direct injection into the myocardium may be associated with alterations in myocardial structure that occur after myocardial ischemia. Our studies have demonstrated that following ischemia there is a significant increase in myocardial interfibrillar space that provides for both longitudinal and transverse myocardial interfibrillar separations (Tansey et al., 2006).

These structural changes are not associated with alterations in conduction velocity anisotropy or in tissue edema but occur coincident with significant decreases in postischemic functional recovery and increased myocardial apoptosis and necrosis. We have hypothesized that these interfibrillar separations allow for the distribution of injected mitochondria within the myocardium.

While the delivery of mitochondria by direct injection is practical for many applications, it does not allow for global distribution of the transplanted mitochondria.

Multiple injections are needed for global distribution within the heart and require organ manipulation to access posterior and lateral aspects. To allow for global distribution of mitochondria we have recently demonstrated that mitochondria can also be delivered to the target organ by vascular infusion (Cowan et al., 2016).

In preliminary investigations, we have found that for optimal distribution 1 x 109 mitochondria in 5 mL respiration buffer is efficacious and multiple injections can be performed. Using this protocol we have demonstrated that vascular delivery of mitochondria through the coronary arteries results in the rapid and widespread distribution of exogenous mitochondria throughout the heart, within 10 minutes and provides for cardioprotection.

To demonstrate uptake and distribution of the transplanted mitochondria we have labeled isolated mitochondria with 18Frhodamine 6G and magnetic iron oxide nanoparticles. The use of these labels allowed for image analysis using positron emission tomography, computed tomography, and magnetic resonance imaging. Our results show that the transplantation of mitochondria by vascular delivery is rapid and effective Decaycorrected measurements of 18Frhodamine 6G using a dose calibrator revealed most of the 18Frhodamine 6G labeled mitochondria remained contained within the injected hearts throughout reperfusion (77.3% ± 5.5, mean ± SEM).

Positron emission tomography and computed tomography revealed that the transplanted mitochondria were distributed from the heart apex to the base. Quantitative assessment of perfused mitochondrial position in the heart tissue demonstrated that 24.76% ± 2.50 (mean ± SEM) and 23.64% ± 2.42 (mean ± SEM) of the transplanted mitochondria were associated with cardiomyocytes and blood vessels, respectively (Cowan et al., 2016).

To demonstrate the efficacy of vascular delivery of mitochondria to the heart, we delivered unlabeled mitochondria to the regionally ischemic heart. In these experiments we demonstrated that vascular delivery of mitochondria through the coronary arteries following transient ischemia and reperfusion significantly decreased myocardial infarct size and significantly enhanced postischemic functional recovery. The reductions in infarct size and the enhancement of regional functional recovery achieved with vascular delivery of mitochondria are not significantly different from that obtained by direct injection of mitochondria (McCully et al., 2009; Masuzawa et al., 2013; Cowan et al., 2016). These data indicate that autologous mitochondrial transplantation is efficacious as a cardioprotective therapy whether these organelles ae delivered by directly injection or delivered by vascular infusion through the coronary arteries.

2.3 Localization to endorgan by vascular delivery
In all our studies, we have noted that the distribution of mitochondria following delivery by direct injection or by vascular infusion remains within the heart and is not detectable in other organs. This finding is important as the delivery of mitochondria by vascular infusion provides for localized therapy without crosscontamination to other endorgans. In the heart we deliver mitochondria by injection into the coronary arteries to avoid systemic distribution; however, we have also delivered mitochondria to the lung by vascular infusion through the pulmonary artery.

In these studies, the mitochondria were labeled with 18Frhodamine 6G as above. Positron emission tomography and computed tomography showed that the mitochondria were localized in the lung and were not detectable in any other areas of the body.

At present, we do not have a mechanism for this “endorgan homing”, where the transplanted mitochondria are retained by the immediate downstream organ, but suggest that this observation may play an important therapeutic role in future studies and applications using mitochondrial transplantation.

2.4 Mechanisms of mitochondrial uptake and internalization
In previous studies, we have investigated a variety of mechanisms that may be associated with mitochondrial uptake and internalization following mitochondrial. These studies were performed using well established pharmacological blockers of clathrin mediated endocytosis, actinmediated endocytosis, macropinocytosis, and tunneling nanotubes (Le et al., 2000; BereiterHahn Jet al., 2008; Lou et al., 2012; Islam et al., 2012; Huang et al., 2013; Kitani et al., 2014). Our studies demonstrated that autologous mitochondria delivered by direct injection are internalized by actindependent endocytosis (Pacak et al., 2015).

Mitochondrial uptake by vascular delivery appears to be more complex. The rapid and widespread uptake of mitochondria when delivered by vascular infusion would suggest that mechanisms allowing for the rapid passage of mitochondria through the vascular wall are involved. Previous studies support the concept that cells can routinely escape from the circulation. It has been previously shown that certain cardiac and mesenchymal stem cells appear to be actively expelled from the vasculature in a process different from diapedesis (Cheng et al., 2012; Allen et al., 2017).

Transmigration of stem cells through the vascular wall requires extensive remodeling of the endothelium (Allen et al., 2016). Cheng et al., 2012 have suggested that this occurs in three stages 1) adhesion of infused cells to the microvessel lining; 2) pocketing of infused cells by endothelial projections; 3) breakdown of the adjacent vascular wall, releasing cells into the interstitium.

The first two steps require integrindependent interactions between transplanted cells and host endothelium, while matrix metalloproteinases mediate the subsequent breakdown of the microvessel wall. These steps are unlikely to occur rapidly or to be associated with the mitochondrion.

Another possible mechanism for mitochondrial uptake may be diapedesislike. Previous studies have shown that some cells routinely escape from the circulation. For example, leukocyte extravasation (i.e. diapedesis) between venous endothelial cells is a wellunderstood process that involves cell adhesion proteins.

It is unlikely, however, that isolated, exogenous mitochondria use a similar mechanism as leukocytes to move through the wall of blood vessels as they do not express the array of proteins involved in diapedesis on their outer membrane (Pagliarini et al., 2008; Calvo et al., 2010).

Whether mitochondria pass between or through endothelial cells and the region of the vasculature at which this process occurs remain to be determined. The size of the isolated mitochondria and the rapidity of their uptake by vascular perfusion would not appear to support any currently defined mechanisms. At present, we are investigating several possible mechanisms of mitochondrial uptake by vascular infusion; but, have yet to conclusively identify a definitive mechanistic route.

3. Mitochondrial transplantation for cardioprotection

3.1 Animal models
In the isolated perfused rabbit heart model and subsequent studies in the in vivo rabbit and pig heart models, we have investigated the use of mitochondrial transplantation as a cardioprotective therapy (McCully et al., 2009; Masuzawa et al., 2013; Cowan et al., 2016; Kaza et al., 2016). In these studies, the myocardium was made temporarily ischemic by ligating the left anterior descending artery with a snare. This temporary ligation results in the attenuation or cessation of coronary blood flow such that oxygen delivery to the myocardium is insufficient to meet oxygen demand. The resulting injury is termed ischemia/reperfusion injury and is characterized by the loss of myocardial cell viability and decreased contractile function within the area at risk. In general, we subject 2530% of the left ventricular mass to ischemia, resulting in a loss in cell viability of approximately 30% and a reduction in contractile force of approximately 25% based on regional systolic shortening. These decrements in cell viability and function are reproducible between large animal models and mimic events occurring in human acute myocardial infarction or surgical intervention during cardiopulmonary bypass. Following 30 minutes of temporary ligation the snare is released and coronary blood flow to the region is reestablished. To show the efficacy of mitochondrial transplantation, we typically deliver autologous mitochondria by direct injection or by vascular delivery, just prior to or at the very start of reperfusion. Control hearts receive vehicle alone (respiration buffer with no mitochondria).

3.2 Effects of mitochondrial transplantation on arrhythmogenicity
The transplantation of mitochondria has similarities in methodology with stem cell transplantation. In stem cell transplantation using skeletal muscle myoblasts, it has been reported that skeletal muscle myoblasts, clustering of the cells can occur, resulting in arrhythmia with postoperative episodes of sustained tachycardia due to alterations in electrical coupling (Macia et al., 2009). To demonstrate that mitochondrial transplantation is not proarrhythmic we have used serial 12 lead electrocardiogram (ECG) analysis and optical mapping (Masuzawa et al., 2013). Our results show that there is no proarrhythmogenicity associated with mitochondrial transplantation. We observed no ventricular tachycardia, bradycardia, fibrillation, or conduction system defects or repolarization heterogeneity associated with mitochondrial transplantation. In addition, there were no changes in serial ECG, QRS duration or corrected QT interval. There was no evidence of any changes associated with ventricular wall motion disturbances, left ventricle hypertrophy, valve dysfunction, fibrosis, or pericardial effusion either at the time of injection, or at any time up to 4 weeks following transplantation of autogeneic mitochondria (Masuzawa et al., 2013).
To confirm these findings, we also performed optical mapping (Masuzawa et al., 2013). In these studies, a 400fold increase in mitochondria, 8.4 x 107/gram tissue wet weight as compared to 2 x 105/gram tissue wet weight, was directly injected into the heart. The number of mitochondria injected per site was significantly greater than that used in the in situ heart (4.2 × 108 vs. 1.2 × 106), so that any acute arrhythmogenic responses could be observed. Our results showed that even with this highly increased mitochondrial load, sequential isopotential maps from the left ventricles injected with mitochondria showed no detectable abnormal impulse propagation on the myocardial surface associated with mitochondrial transplantation.

3.3 Effects of mitochondrial transplantation on immune and autoimmune response
In all our studies, we have used autologous mitochondria isolated from the patient’s own body for cardioprotection. The use of autologous tissue was based on the assumption that this approach would not cause an immune response and avoid the need for antirejection therapy required for nonautologous cellbased therapies (Kofidis et al., 2005). To confirm these expectations serial analysis immune and inflammatory markers was performed. The effects of mitochondrial transplantation were also investigated using multiplex (42plex) analysis of cytokines and chemokines (Masuzawa et al., 2013). The results from these studies confirmed that there was no immune or inflammatory response associated with autologous mitochondrial transplantation (Masuzawa et al., 2013). In addition there was no upregulation of cytokines associated with the immune response that is seen in patients with acute heart transplantation rejection (Rose, 2011).
The possibility of autoimmune response due to the presence of increased mitochondrial number in the myocardium was also investigated. The need for these studies was based on previous studies indicating that oxidative modification of E2 subunits of mitochondria pyruvate dehydrogenase, branched chain 2oxoacid dehydrogenase, and 2oxoglutarate dehydrogenase is a critical step leading to the induction of an autoimmune response in the liver as demonstrated by the presence of antimitochondrial antibodies (Leung et al., 2007). Indirect immunofluorescence was used to test for the presence of antimitochondrial antibodies (AMA) in serial blood samples. AMAs were not detected in the serum of any animals treated with autologous mitochondrial transplantation indicating that the transplantation of mitochondria does not induce an autoimmune response (Masuzawa et al., 2013).
3.4 Effects of mitochondrial transplantation on cellular viability and function

Our results have demonstrated that direct injection or vascular delivery of mitochondria to the heart rescues cell function and myocardial contractile function following ischemia and reperfusion. Creatine kinaseMB isoenzyme (CKMB) and cardiac troponin–I (cTnI) are specific and sensitive markers of myocardial injury, and elevated levels indicate myocardial injury (Pourafkari et al., 2015). Mitochondrial transplantation significantly decreased serum CKMB and cTnI indicating that myocardial injury following 30 minutes of transient ischemia was decreased (Masuzawa et al., 2013; Kaza et al., 2016). These effects were confirmed by infarct analysis using triphenyl tetrazolium chloride analysis to determine necrosis and terminal deoxynucleotidyl transferasemediated dUTP nickend labeling (TUNEL) and caspase activity to determine apoptosis in hearts treated with mitochondrial transplantation and those treated with vehicle alone (Masuzawa et al., 2013). Our results demonstrated that mitochondrial transplantation significantly decreased myocardial injury, including both necrosis and apoptosis, resulting from transient ischemia.
Increased myocardial cellular viability would be expected to correlate with enhanced myocardial function and our studies confirm this assumption. Our results show that 10 minutes following mitochondrial transplantation myocardial function is significantly enhanced as compared to hearts receiving injection of respiration media (vehicle) alone and that this function remains enhanced for at least 28 days – the end point of our studies (Masuzawa et al., 2013; Kaza et al., 2016). This is in contrast to hearts receiving vehicle alone that had persistent left ventricular hypokinesis.
3.5 Mechanisms of mitochondrial transplantation
The mechanisms through which mitochondrial transplantation provides cardioprotection have yet to be fully elucidated. At present, our studies have shown that the transplanted mitochondria act both extraand intracellularly. Once transplanted, the mitochondria increase total tissue ATP content and ATP synthesis. This increase in high energy acts rapidly, as early

as 10 minutes following delivery of the mitochondria to the heart, to enhance cardiac function as determined by echocardiography and pressure volume measurement. The mitochondria then act to upregulate proteomic pathways for the mitochondrion and the generation of precursor metabolites for energy and cellular respiration (P < 0.05, Enrichment Score > 2.0) (Masuzawa et al., 2013).
At 10 minutes to one hour following transplantation the transplanted mitochondrial are internalized into cardiomyocytes, by actindependent endocytosis (Pacak et al., 2015). Once internalized, the transplanted mitochondria further increase cardiomyocyte ATP content and upregulate cardioprotective cytokines (Masuzawa et al., 2013). These cytokines have been shown to be associated with enhanced cardiac function by stimulating cell growth, proliferation, and migration, enhancing vascularization, providing protection against cardiomyocyte apoptosis and improving functional cardiac recovery and cardiac remodeling independent of cardiac myocyte regeneration (Masuzawa et al., 2013).
We have recently shown that transplanted mitochondria also act at the mitochondrial genomic level. In previous experiments, we have shown that following ischemia there is damage to mitochondrial DNA resulting in the reduction of ATP synthesis (Levitsky et al., 2003). These alterations were associated with poor recovery following cardiac surgery in humans. Our studies demonstrate that mitochondrial transplantation replaces damaged mitochondrial DNA with intact mitochondrial DNA and rescues myocardial cell function (Pacak et al., 2015).
The transplanted mitochondria maintain viability and function for at least 28 days, the limit of our studies (Masuzawa et al., 2013; Cowan et al., 2016; Kaza et al., 2016). This is in contrast to xenoand allotransplanted cells that are rapidly rejected leading to the loss of transplanted cells, despite the use of antirejection pharmaceuticals (Yau et al., 2003; Hamamoto et al., 2009).

4 Human application
Premised upon these in vivo studies demonstrating the efficacy of mitochondrial transplantation for cardioprotection we have recently performed the first clinical application of mitochondrial transplantation (Emani et al., 2017). The study was performed in pediatric patients who suffered myocardial ischemiareperfusion injury. All procedures were performed under an Innovative Therapies process developed by the Boston Children’s Hospital Institutional Review Board. An individual review of the proposed therapy for each patient was provided by two independent physicians, not involved in the patient’s care. Families were extensively counseled regarding the experimental nature of the procedure and a separate Innovative Therapies consent form was signed.
Five pediatric patients in critical condition who were unable to be weaned off extracorporeal membrane oxygenation (ECMO) support due to myocardial dysfunction related to ischemia and reperfusion were treated with autologous mitochondria. Patient diagnosis included dextrotransposition of the great arteries (4 days and 25 days of age ), hypoplastic left heart syndrome (6 days), left ventricular outflow tract obstruction (6 months of age) and tricuspid atresia 1B (2 years of age) (Emani et al., 2017).
The cause of ischemia was coronary artery obstruction that was relieved in 4 patients, and LV distension with subendocardial ischemia in one patient. The autologous mitochondria were isolated from the patient’s rectus abdominis muscle. The patients received 10 mitochondrial injections, 100 uL each containing 1 x 107 ± 1 x 104 mitochondria. The mitochondria were delivered to the myocardium by direct injection with a 1 mL tuberculin syringe (28gauge needle). All injections were delivered to the area affected by ischemiareperfusion that was identified by epicardial echocardiography as being hypokinetic. Following mitochondrial transplantation, all 5 patients had significant improvement in their myocardial systolic function. Epicardial echocardiography showed moderate to severe systolic function ventricular dysfunction with regional hypokinesis prior to treatment (Emani et al., 2017). Ventricular function was improved to mildmoderate to normal systolic function at 46 days following autologous mitochondrial transplantation and improved to mild dysfunction in one patient and normal systolic function with no regional hypokinesia detected in any patient at 10 days following autologous mitochondrial transplantation (Emani et al., 2017).

All but one patient were successfully weaned off ECMO support by the 2nd day post mitochondrial transplantation. The single patient who was unable to wean off ECMO support suffered irreversible multiorgan failure despite the recovery of myocardial function following mitochondrial transplantation. This patient was on ECMO support for 15 days prior to treatment with mitochondrial transplantation. There were no adverse complications such as arrhythmia, intramyocardial hematoma or scarring with mitochondrial transplantation, in agreement with our animal studies. This case study demonstrates for the first time the potential role mitochondrial transplantation to improve ventricular dysfunction following ischemiareperfusion injury in humans.

While this is the first clinical usage of mitochondrial transplantation in humans, the same protocol can be used in adults and in other settings of ischemiareperfusion injury (Emani et al., 2017). The ability to use mitochondrial transplantation for clinical intervention in situations such as the stunned myocardium is enhanced by the fact that mitochondrial harvest and isolation can be performed within 2030 minutes during the same procedure and involves minimal manipulation of muscle tissue.

5 The timing of mitochondrial transplantation delivery
Studies by us and by others have shown that the mechanisms associated with ischemic myocardial injury converge on the mitochondrion. Rapidly following the onset of ischemia there are alterations in mitochondrial structure, complex activity, oxygen consumption, high energy synthesis and changes in mitochondrial transcriptomics and proteomics.

All these changes occur during ischemia and persist following reestablishment of coronary blood flow (reperfusion). For practical efficacy we therefore deliver the transplanted mitochondria just prior to reperfusion or during early reperfusion in order to limit the effects of ischemia on the transplanted mitochondria. We reasoned that if the mitochondria were transplanted at the start of ischemia they too would be damaged. This approach has been shown to be efficacious in our animal studies. In the human trial described above the delivery of mitochondria was many days after the ischemic insult. In these cases, the patient’s heart was unable to provide sufficient contractile force to be weaned from ECMO (Emani et al., 2017).

We believe that the role of mitochondrial transplantation is the rescue of cells and cellular function. This is premised on our animal studies. The results obtained in the clinical studies in humans are most likely the result of reversal of myocardial stunning. Stunning “describes the mechanical dysfunction that persists after reperfusion despite the absence of myocellular damage and despite the return of normal or nearnormal perfusion (Kloner et al., 1998). Mentzer, 2011, has noted that myocardial stunning, is a frequent consequence after heart surgery and is characterized by a requirement for postoperative inotropic support despite a technically satisfactory heart operation. In the stunned heart the myocardial cells remain alive but there is a prolonged depression of cardiac contractility after reperfusion. This depression in contractility can last days but with extended time results in patient mortality.
In the human cases in which we have used mitochondrial transplantation it is likely that we have rescued the stunned myocardium. The mechanisms most likely involve those we have demonstrated in our animal models, namely, restoration of high energy synthesis and replacement of damaged mitochondrial DNA. The veracity of these mechanisms remains to be elucidated.

6 Mitochondrial transplantation for the rescue of other tissues
While our studies have focussed on the heart and ischemia and reperfusion, other groups have shown that mitochondrial transplantation can be used to enhance drug sensitivity in human breast cancer cells (Elliott et al., 2012); to rescue cell function in cells harboring the mitochondrial DNA mutation (Chang et al., 2013); Parkinson’s disease (Chang et al., 2016); liver ischemia/reperfusion injury (Lin et al., 2013); in cellular studies demonstrating that isolated mitochondria rescue mitochondrial respiratory function and improved the cellular viability in cardiomyocytes (Kitani et al., 2014) and neurorecovery after stroke ( Hayakawa et al., 2016).

These studies demonstrate the potential of mitochondrial transplantation in a variety of diseases. The utility in other organ related diseases and syndromes remains to be investigated. However, diabetes, Alzheimer’s disease and dementia, posttraumatic stress disorder, concussion and others have all been shown to be associated with alterations occurring at or affecting mitochondrial function. Included in these pathological disorders are ischemiareperfusion events affecting pulmonary, renal, hepatic, cerebral, ocular and skeletal muscles. We expect that the application and usage of mitochondrial transplantation will provide for a simple and efficacious therapeutic approach to many of these disease and will significantly ameliorate morbidity and mortality.

References
Akhmedov, A.T., Rybin, V., MarínGarcía, J., 2015. Mitochondrial oxidative metabolism and uncoupling proteins in the failing heart. Heart Fail. Rev. 20, 227249.
Allen, T.A., Gracieux, D., Talib, M., Tokarz, D.A., Hensley, M.T., Cores, J., Vandergriff, A., Tang, J., de Andrade, J.B., Dinh, P.U., Yoder, J.A., Cheng, K., 2017. Angiopellosis as an Alternative Mechanism of Cell Extravasation. Stem Cells. 35,170180.
BereiterHahn, J., Vöth, M., Mai, S., Jendrach, M., 2008. Structural implications of mitochondrial dynamics. Biotechnol. J. 3, 765780.
Black, K.M., Barnett, R., Bhasin, M.K., Daly, C., Dillon, S.T., Libermann, T.A., Levitsky, S., McCully, J.D., 2012, Microarray and Proteomic Analysis of Cardioprotection in the Mature and Aged Male and Female. Physiol. Genomics 44,10271041.
Calvo, S.E., Mootha, V.K., 2010, The mitochondrial proteome and human disease. Annu Rev Genomics Hum. Genet. 11, 2544.
Chang, J.C., Liu, K.H., Li, Y.C., Kou, S.J., Wei, Y.H., Chuang, C.S., Hsieh, M., Liu, C.S., 2013, Functional recovery of human cells harbouring the mitochondrial DNA mutation MERRF A8344G via peptidemediated mitochondrial delivery. Neurosignals. 21,160173.
Chang, J.C., Wu, S.L., Liu, K.H., Chen, Y.H., Chuang, C.S., Cheng, F.C., Su, H.L., Wei, Y.H., Kuo, S.J., Liu, C.S., 2016, Allogeneic/xenogeneic transplantation of peptidelabeled mitochondria in Parkinson’s disease: restoration of mitochondria functions and attenuation of 6hydroxydopamine–induced neurotoxicity. Translational Research. 170, 4056.
Chen, Q., Moghaddas, S., Hoppel, C.L., Lesnefsky, E.J., 2008, Ischemic defects in the electron transport chain increase the production of reactive oxygen species from isolated rat heart mitochondria. Am. J. Physiol. Cell. Physiol. 294, C460C466.
Cheng, K., Shen, D., Xie, Y., Cingolani, E., Malliaras, K., Marbán, E., 2012, Brief report: Mechanism of extravasation of infused stem cells. Stem Cells. 30, 28352842.
Cowan, D.B., Yao, R., Akurathi, V., Snay, E.R., Thedsanamoorthy, J.K., Zurakowski, D., Ericsson, M., Friehs, I., Wu, Y., Levitsky, S., del Nido, P.J., Packard, A.B., McCully, J.D., 2016, Intracoronary Delivery of Mitochondria to the Ischemic Heart for Cardioprotection. PLoS One. e0160889. doi: 10.1371/journal.pone.0160889. eCollection 2016.
Doenst, T., Nguyen, T.D., Abel, E.D., 2013, Cardiac metabolism in heart failure: implications beyond ATP production. Circ. Res. 113, 709724.
Durhuus, J.A., Desler, C., Rasmussen, L.J., 2015, Mitochondria in health and disease 3rd annual conference of society for mitochondrial research and medicine 1920 December 2013 Bengaluru, India. Mitochondrion. 20, 712.
Elliott, R. L., Jiang, X. P., Head, J. F., 2012, Mitochondria organelle transplantation: introduction of normal epithelial mitochondria into human cancer cells inhibits proliferation and increases drug sensitivity. Breast Cancer Res. Treat. 136, 347–354.

Emani, S.M., Piekarski, B.L., Harrild, D., del Nido, P.J., McCully, J.D., 2017, Autologous Mitochondria Transplantation for Ventricular Dysfunction following Myocardial IschemiaReperfusion Injury. In press J. Thorac. Cardiovasc. Surg. DOI: http://dx.doi.org/10.1016/j.jtcvs.2017.02.018
Faulk, E.A., McCully, J.D., Tsukube, T., Hadlow, N.C., Krukenkamp, I.B., Levitsky, S., 1995, Myocardial mitochondrial calcium accumulation modulates nuclear calcium accumulation and DNA fragmentation. Annals Thorac. Surg. 60,338344.
Faulk, E.A., McCully, J.D., Hadlow, N.C., Tsukube, T., Krukenkamp, I.B., Federman, M., Levitsky, S., 1995a, Magnesium cardioplegia enhances mRNA levels and the maximal velocity of cytochrome oxidase I in the senescent myocardium during global ischemia. Circulation 92, 405412.
FernándezVizarra, E., Ferrín, G., PérezMartos, A., FernándezSilva, P., Zeviani, M., Enríquez, J.A., 2010, Isolation of mitochondria for biogenetical studies: An update. Mitochondrion. 10, 53262.
Fillmore, N., Lopaschuk, G.D., 2013, Targeting mitochondrial oxidative metabolism as an approach to treat heart failure. Biochim. Biophys. Acta. 1833, 857865.
Frezza, C., Cipolat, S., Scorrano, L., 2007, Organelle isolation: functional mitochondria from mouse liver, muscle and cultured fibroblasts. Nat. Protoc. 2, 287295.
Graham, J.M., 2001, Isolation of mitochondria from tissues and cells by differential centrifugation. Curr. Protoc. Cell Biol. Chapter 3, Unit 3.3.
Hausenloy, D.J., Barrabes, J.A., Bøtker, H.E., Davidson, S.M., Di Lisa,F., Downey, J., Engstrom, T., Ferdinandy, P., CarbreraFuentes, H.A., Heusch, G., Ibanez, B., Iliodromitis, E.K., Inserte, J., Jennings, R., Kalia, N., Kharbanda, R., Lecour, S., Marber, M., Miura, T., Ovize, M., PerezPinzon, M.A., Piper, H.M., Przyklenk, K., Schmidt, M.R., Redington, A., RuizMeana, M., Vilahur, G., VintenJohansen, J., Yellon, D.M., GarciaDorado, D., 2016, Ischaemic conditioning and targeting reperfusion injury: a 30 year voyage of discovery. Basic Res. Cardiol. 111,70.
Hsiao, F.C., Tung, Y.C., Chou, S.H., Wu, L.S., Lin, C.P., Wang, C.L., Lin, Y.S., Chang, C.J., Chu, P.H., 2015, FixedDose Combinations of ReninAngiotensin System Inhibitors and Calcium Channel Blockers in the Treatment of Hypertension: A Comparison of Angiotensin Receptor Blockers and AngiotensinConverting Enzyme Inhibitors. Medicine (Baltimore). 94:e2355
Huang, X., Sun, L., Ji, S., Zhao, T., Zhang, W., Xu, J., Zhang, J., Wang, Y., Wang, X., FranziniArmstrong, C., Zheng, M., Cheng, H., 2013, Kissing and nanotunneling mediate intermitochondrial communication in the heart. Proc. Natl. Acad. Sci. U. S. A. 110, 28462851.
Hamamoto, H., Gorman, J.H. 3rd, Ryan, L.P., Hinmon, R., Martens, T.P., Schuster, M.D., Plappert, T., Kiupel, M., St JohnSutton, M.G., Itescu, S., Gorman, R.C., 2009, Allogeneic mesenchymal precursor cell therapy to limit remodeling after myocardial infarction: the effect of cell dosage. Ann. Thorac. Surg. 87, 794801.
Hayakawa, K., Esposito, E., Wang, X., Terasaki, Y., Liu, Y., Xing, C., Ji, X., Lo, E.H., 2016, Transfer of mitochondria from astrocytes to neurons after stroke. Nature. 535, 551555.

Islam, M.N., Das, S.R., Emin, M.T., Wei, M., Sun, L., Westphalen, K., Rowlands, D.J., Quadri, S.K., Bhattacharya, S., Bhattacharya, J., 2012, Mitochondrial transfer from bonemarrowderived stromal cells to pulmonary alveoli protects against acute lung injury. Nat. Med. 18, 759765.
Kalogeris ,T., Baines ,C.P., Krenz, M., Korthuis, R.J., 3012, Cell biology of ischemia/reperfusion injury. Int. Rev. Cell. Mo.l Biol. 298:229317.
Kalogeris, T., Baines, C.P., Krenz, M., Korthuis, R,J., 2016, Ischemia/Reperfusion. Compr. Physiol. 7:113170.
Kaza, A.K., Wamala, I., Friehs, I., Kuebler, J.D., Rathod, R.H., Berra, I., Ericsson, M., Yao, R., Thedsanamoorthy. J.K., Zurakowski, D., Levitsky, S., del Nido, P.J., Cowan, D.B., McCully, J.D., 2016, Myocardial Rescue with Autologous Mitochondrial Transplantation in a Porcine Model of Ischemia/Reperfusion. In press J. Thorac. Cardiovas. Surg. DOI: http://dx.doi.org/10.1016/j.jtcvs.2016.10.077
Kitani, T., Kami, D., Matoba, S., Gojo, S., 2014, Internalization of isolated functional mitochondria: involvement of macropinocytosis. J. Cell. Mol. Med. 18, 16941703.
Kloner, R.A.,, Bolli, R., Marban, E., et al., 1998, Medical and cellular implications of stunning, hibernation and preconditioning. An NHLBI Workshop. Circulation. 97,1848–1867.
Kofidis, T., Weissman, I., Fedoseyeva, E., Haverich, A., Robbins, R.C., deBruin, J.L., Tanaka, M., Zwierzchoniewska, M., 2005, They are not stealthy in the heart: embryonic stem cells trigger cell infiltration, humoral and Tlymphocytebased host immune response. Eur J. Cardiothorac. Surg. 28, 461466.
Kolwicz, S.C. Jr, Purohit, S., Tian, R. 2013, Cardiac metabolism and its interactions with contraction, growth, and survival of cardiomyocytes. Circ. Res. 113, 603616.
Kurian, G.A., Berenshtein, E., Kakhlon, O., Chevion, M., 2012, Energy status determines the distinct biochemical and physiological behavior of interfibrillar and subsarcolemmal mitochondria. Biochem. Biophys. Res. Commun. 428,376382.
Laskowski, M., Augustynek, B., Kulawiak, B., Koprowski, P., Bednarczyk, P., Jarmuszkiewicz, W., Szewczyk, A., 2016, What do we not know about mitochondrial potassium channels? Biochim. Biophys. Acta. 1857,2471257.
Le, P.U., Benlimame, N., Lagana, A., Raz, A., Nabi, I.R., 2000, Clathrinmediated endocytosis and recycling of autocrine motility factor receptor to fibronectin fibrils is a limiting factor for NIH3T3 cell motility. J. Cell. Sci. 113, 32273240.
Lesnefsky, E.J., Hoppe,l C.L., 2003, Ischemiareperfusion injury in the aged heart: role of mitochondria. Arch. Biochem. Biophys. 420:287297.
Lesnefsky, E.J., Chen, Q., Slabe, T.J., Stoll, M.S., Minkler, P.E., Hassan, M.O., Tander. B., Hoppel, C,L.. 2004,Ischemia, rather than reperfusion inhibits respiration through cytochrome oxidase in the isolated perfused rabbit heart: role of cardiolipin. Am. J. Phys. Heart Circ. Phys. 287, H258H267.

Lesnefsky EJ, Chen Q, Tandler B, Hoppel CL. Mitochondrial Dysfunction and Myocardial IschemiaReperfusion: Implications for Novel Therapies. Annu Rev Pharmacol Toxicol. 2017 6;57:535565
Leung, P.S., Rossaro, L., Davis, P.A., Park,O., Tanaka, A., Kikuchi, K., Miyakawa, H., Norman, G.L., Lee, W., Gershwin, M.E., 2007, Antimitochondrial antibodies in acute liver failure: implications for primary biliary cirrhosis. Hepatology 46, 14361442.
Levitsky, S., Laurikka, J., Stewart, R.D., Campos, C.T., Lahey, S.J., McCully, J.D., 2003, Mitochondrial DNA deletions in coronary artery bypass grafting patients. European Society for Surgical Research International Proceedings 38,149153.
Lin, H. C., Liu, S. Y., Lai, H. S., Lai I. R., 2013, Isolated mitochondria infusion mitigates ischemiareperfusion injury of the liver in rats. Shock. 39, 304310.
Lou, E., Fujisawa, S., Morozov, A., Barlas, A., Romin, Y., Dogan, Y., Gholami, S., Moreira, A.L., ManovaTodorova, K., Moore, M.A., 2012 Tunneling nanotubes provide a unique conduit for intercellular transfer of cellular contents in human malignant pleural mesothelioma. PLoS One. 2012;7:e33093.
Macia, E., Boyden, P.A., 2009, Stem cell therapy is proarrhythmic. Circulation 119, 18141823.
Madonna, R., Cadeddu, C., Deidda, M., Giricz, Z., Madeddu, C., Mele, D., Monte, I., Novo, G., Pagliaro, P., Pepe, A., Spallarossa, P., Tocchetti, C.G., Varga, Z.V., Zito, C., Geng, Y.J., Mercuro, G., Ferdinandy, P., 2015,Cardioprotection by gene therapy: A review paper on behalf of the Working Group on Drug Cardiotoxicity and Cardioprotection of the Italian Society of Cardiology. Int. J. Cardiol. 191, 203210.
Masuzawa, A., Black, K.M., Pacak, C.A., Ericsson, M., Barnett, R.J., Drumm, C., Seth, P., Bloch, D.B., Levitsky, S., Cowan, D.B., McCully, J.D., 2013, Transplantation of autologouslyderived mitochondria protects the heart from ischemiareperfusion injury. Am. J. Phys. Heart Circ. Physiol. 304, H966H982.
McCully, J.D., Levitsky, S., 2003, The Mitochondrial KATP Channel and Cardioprotection. Ann. Thorac. Surg. 75, S667S673.
McCully JD, Rousou AJ, Parker RA, Levitsky S. Age and gender differences in mitochondrial oxygen consumption and free matrix calcium during ischemia/reperfusion and with cardioplegia and diazoxide. Ann. Thorac. Surg. 2007;83 11021109.
McCully, J.D., Cowan, D.B., Pacak, C.A., Levitsky, S., 2009, Injection of Isolated Mitochondria During Early Reperfusion for Cardioprotection. Am. J. Phys. Heart Circ. Physiol. 296, 94105.
Mentzer, R.M. Jr., 2011, Myocardial protection in heart surgery J. Cardiovasc. Pharmacol. Ther. 16, 290297.
Olson, M.S., Von Korff, R.W., 1967, Changes in endogenous substrates of isolated rabbit heart mitochondria during storage. J. Biol. Chem. 242,325332.
Ong, S.B., Samangouei, P., Kalkhoran, S.B., Hausenloy, D.J., 2015 The mitochondrial permeability transition pore and its role in myocardial ischemia reperfusion injury. J. Mol. Cell. Cardiol. 78:2334.

OrenesPiñero, E., Valdés, M., Lip, G.Y., Marín, F., 2015, A comprehensive insight of novel antioxidant therapies for atrial fibrillation management. Drug Metab. Rev. 47, 388400.
Pacak, A.P., Preble, J.M., Kondo, H., Seibel, P., Levitsky, S., del Nido, P.J., Cowan, D.B., McCully, J.D., 2015, ActinDependent Mitochondrial Internalization in Cardiomyocytes: Evidence for Rescue of Mitochondrial Function. Biol. Open. 4, 622626.
Pagliarini, D.J., Calvo, S.E., Chang, B., Sheth, S.A., Vafai, S.B., Ong, S.E., Walford, G.A., Sugiana, C., Boneh, A., Chen, W.K., Hill, D.E., Vidal, M., Evans, J.G., Thorburn, D.R., Carr, S.A., Mootha, V.K., 2008, A mitochondrial protein compendium elucidates complex I disease biology. Cell. 34, 1223.
Pallotti, F., Lenaz, G., 2007, Isolation and subfractionation of mitochondria from animal cells and tissue culture lines. Methods Cell Biol. 80, 344.
Pourafkari, L., Ghaffari, S., Afshar, A.H., Anwar, S., Nader, N.D., 2015, Predicting outcome in acute heart failure, does it matter? Acta. Cardiol. 70, 653663.
Preble, J.M., Pacak, C.A., Kondo, H., McKay, A.A., Cowan, D.B., McCully, J.D., 2014, Rapid Isolation and Purification of Mitochondria for Transplantation. J. Vis. Exp. 91: e51682. doi: 10.3791/51682.
Preble, J.M., Kondo, H., Levitsky, S., McCully, J.D., 2014a, Quality Control Parameters for Mitochondria Transplant in Cardiac Tissue. JSM Biochem. Mol. Biol. 2014 2(1): 1008.
Riva, A., Tandler, B., Loffredo, F., Vazquez, E., Hoppel, C., 2005, Structural differences in two biochemically defined populations of cardiac mitochondria. Am. J. Physiol. Heart. Circ. Physiol. 289, H868H872.
Rosca, M.G., Hoppel, C.L., 2013, Mitochondrial dysfunction in heart failure. Heart Fail. Rev. 18, 607622.
Rose, N.R., 2011, Critical cytokine pathways to cardiac inflammation. J. Interferon Cytokine Res. 31, 705710.
Rousou, A.J., Ericsson, M., Federman, M., Levitsky, S., McCully, J.D., 2004, Opening of mitochondrial KATP enhances cardioprotection through the modulation of mitochondrial matrix volume, calcium accumulation and respiration. Am. J. Physiol. Heart Circ. Physiol. 287, H1967H1976.
Schmitt, S., Saathoff, F., Meissner, L., Schropp, E.M., Lichtmannegger, J., Schulz, S., Eberhagen, C., Borchard, S., Aichler, M., Adamski, J., Plesnila, N., Rothenfusser, S., Kroemer, G., Zischka, H.,2013, A semiautomated method for isolating functionally intact mitochondria from cultured cells and tissue biopsies. Anal. Biochem. 443, 6674.
Suleiman, M.S., Halestrap, A.P., Griffiths, E.J., 2001, Mitochondria: a target for myocardial protection. Pharmacol. Ther. 89, 2946.
Tansey, E.E., Kwaku, K.F., Hammer, P.E., Cowan, D.B., Federman, M., Levitsky, S.,. McCully, J.D., 2006, Reduction and Redistribution of Gap and Adherens Junction Proteins Following Ischemia/Reperfusion. Ann. Thorac. Surg. 82, 14721479.

Toyoda, Y., Friehs, I., Parker, R.A., Levitsky, S., McCully, J.D., 2000, Differential role of sarcolemmal and mitochondrial KATP channels in adenosine enhanced ischemic preconditioning. Am. J. Phys. Heart Circ. Physiol. 279, H2694H2703.
Toyoda, Y., Levitsky, S., McCully, J.D., 2001, Opening of mitochondrial ATPsensitive potassium channels enhances cardioplegic protection. Ann. Thorac. Surg. 71, 12811289.
Tsukube, T., McCully, J.D., Metz, R.M., Cook, C.U., Levitsky, S., 1997, Amelioration of ischemic calcium overload correlates with high energy phosphates in the senescent myocardium. Am. J. Physiol. (Heart Circ. Physiol.) 273, H418H427.
Wechsler, M.B., 1961, Studies on oxidative phosphorylation and ATPase activity of fresh and frozen brain mitochondria. Arch. Biochem. Biophys. 95,494498.
Wieckowski, M.R., Giorgi, C., Lebiedzinska, M., Duszynski, J., Pinton, P., 2009, Isolation of mitochondriaassociated membranes and mitochondria from animal tissues and cells. Nat. Protoc. 4, 15821590.
Yau, T.M., Tomita, S., Weisel, R.D., Jia, Z.Q., Tumiati, L.C., Mickle, D.A., Li, R.K., 2003, Beneficial effect of autologous cell transplantation on infarcted heart function: comparison between bone marrow stromal cells and heart cells. Ann. Thorac. Surg. 75, 169176.

Sulforaphane a powerful tool to fight cancer, aging, and other inflammatory health issues

Sulforaphane has been shown to be an effective antioxidant, antimicrobial, anticancer, anti-inflammatory, anti-aging, neuroprotective, and anti-diabetic (R). It also protects against cardiovascular and neurodegenerative diseases (R).

Many test-tube and animal studies have found sulforaphane to be particularly helpful for suppressing cancer development by inhibiting enzymes that are involved in cancer and tumor growth (R, R, R).

According to some studies, sulforaphane may also have the potential to stop cancer growth by destroying cells that are already damaged (R, R).

Sulforaphane appears to be most protective against colon and prostate cancer but has also been studied for its effects on many other cancers, such as breast, leukemia, pancreatic and melanoma (R).

Sulforaphane may also help reduce high blood pressure and keep arteries healthy — both major factors in preventing heart disease (R).

Recent research shows that Sulforaphane can help control blood glucose levels in type 2 diabetic patients as effectively as the most commonly used prescription medicine Metformin (R).

Sulforaphane and Broccoli Sprouts

Sulforaphane (SFN) is an isothiocyanate. It is derived from glucoraphanin, found in cruciferous vegetables such as broccoli, cabbage, cauliflower, brussels sprouts and kale (R, R).

Glucoraphanin is stable, but when the vegetables are cut or chewed, it comes in contact with the enzyme myrosinase, that also occurs naturally in these vegetables, and Sulforaphane is formed(RR).

Unlike the glucoraphanin, sulforaphane degrades quickly (R).

The quantity of glucoraphanin varies greatly in different plants. In general, levels of glucoraphanin and sulforaphane are highest in broccoli sprouts (R), but 3 day-old sprouts can contain up to 100 times more glucoraphanin than in mature plants (R).

Sulforaphane  is rapidly absorbed, reaching peak concentration after 1-3 hours. (RR). Levels are back to baseline within 72 hours (RRR).

Daily consumption of cruciferous vegetables can maintain levels of Sulforaphane in the body, if properly prepared (R), however most people find  it is easier to take a daily supplement.

Sulforaphane activation of  AMPK pathway is key to wide range of benefits

There are many hundreds of studies of Sulforaphane’s  effect in fighting various disease and metabolic problems.  Activation or Inhibition of several different genes are described in how it manages to impact such a wide range of health problems.

As with vitamin antioxidants the notion that supplements act as “antioxidants” in human cells is called into question []. Emerging evidence suggests that the most effective supplement exert their intracellular effects not as direct “antioxidants” per se but as modulators of signaling pathways.

Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 – which researchers call the “Master Regulator” of Cell Defense (R).

A list of genes and enzymes Sulforaphane influences is at the bottom of this page.

Perhaps even more meaningful is that like Metformin and Berberine (R), Sulforaphane strongly activates AMPK, which raises the intracellular NAD+ concentrations and activates SIRT1 which has been shown to have numerous disease fighting and anti-aging potential(R).

It’s possible many of the health benefits are at least partially related to this AMPK/NAD+/SIRT activity.

Here is a  short list of studies showing Sulforaphane activating AMPK to fight Cancer(R),Diabetes(R),Obesity(R),Neurological disease (R),Heart disease (R),HIV (R),Colitis(R).

Sulforaphane helps prevent and can even kill cancer

3-5 servings per week of Cruciferous vegetables decrease the risk of cancer by 30-40% (R).

Even ONE serving of cruciferous vegetables per week significantly reduced the risk of pharynx, colorectal, esophageal, kidney and breast cancer (R).

In vitro, Sulforaphane has been demonstrated to kill breast cancer cells (R),oral squamous cell carcinoma cells (R), colorectal cancer cells (R),  cervical, liver, prostate, and  leukemia cancer cells (RR), while having little to no effect on healthy cells (R)

Sulforaphane combats cancer by multiple mechanisms:

  • Sulforaphane reduces inflammation by inhibiting the NF-κB pathway(R).
  • Sulforaphane induces cancer cell death (R).
  • SFN inhibits Phase I enzymes that enable cancer cell growth (R).
  • SFN induces Phase II enzymes that clear  DNA damaging chemicals (R).
  • Sulforaphane thereby inhibits cancer cell proliferation  (R)

In addition to the numerous cancer fighting mechanism of Sulforaphane, it is also very effective at enhancing commonly used anti-cancer drugs such as    cisplatin, gemcitabine, doxorubicin, and 5-fluorouracil    , allowing for smaller dosages and limiting toxicity to healthy cells (R).

Sulforaphane helps lower Cholesterol


Clinical studies with humans has shown eating broccoli reduces LDL cholesterol.

Twelve healthy subjects that consumed 100 grams per day of broccoli sprouts lowered LDL cholesterol, increased HDL cholesterol, and improved maarkers for oxidative stress  (R).

Sulforaphane May Help Parkinson’s, Alzheimers, Huntingtons

In mouse models of Parkinson’s disease, Sulforaphane increased dopamine levels in the brain to alleviate loss of motor coordination(RRRR).

A buildup of amyloid beta ( Aβ ) peptides are thought to be the cause of Alzheimer’s disease.  Broccoli sprouts were shown to prevent amyloid beta buildup and cell death (RR).

Sulforaphane has also bee shown to reduce Aβ plaque, and lessens cognitive impairment in mouse models of Alzheimer’s disease (RRR).

Sulforaphane activates a protein that slows huntingtins disease in mice (R).

Sulforaphane Prevents and Combats Heart & Cardiovascular Disease


Observational studies in humans has shown those who eat 3-5 servings of cruciferous vegetables a week have a significantly decreased risk of cardiovascular disease (R).

Research with mice shows Sulforaphane decreases blood pressure (RR).

Rats that were given Sulforaphane after heart attack exhibited  reduced heart damage  (R).

Sulforaphane helps prevent atherosclerosis (R) and minimizes inflammation caused by hardening of arteries in mice (R).

Sulforaphane reduces formation of  blood clots and platelet aggregation in humans (R).

Lastly, Sulforaphane has proven beneficial in minimizing damage from strokes, with decreased brain tissue damage (R), and loss of neurological function (R).

Sulforaphane helps control Diabetes and fight  Obesity


In humans, eating Broccoli sprouts  increased  HDL cholesterol, and lowered  triglycerides, insulin, insulin resistance,oxidative stress, and C-Reactive Proteins (RRR).

Sulforaphane decreases incidence and severity of the following diabetes complications in mice (RR)

  • vascular complications .
  • diabetes-induced heart dysfunction
  • heart damage in mice
  • nephropathy
  • tissue damage

Mice fed a high fat diet to induce obesity that were subsequently treated with sulforaphane for 3 weeks had significantly less weight gain, and improved insulin resistance, glucose and cholesterol levels (R,R).

Sulforaphane is Antiviral

Eating Broccoli sprouts increase the bodies natural anti-virus response and reduce influenza (R, R).

In vitro, Sulforaphane  combats  influenza, HIV, Epstein-Barr virus (R) and hepatitis C virus (R).

Sulforaphane Combats Bacterial and Fungal Infections

Human β-defensin-2 (HBD-2) is a key part of our defense against bacterial invasion. Sulforaphane increases HBD-2 in response to  to 23 of 28 bacterial species (R).

Cystic fibrosis patients have increased levels of Mycobacterium abscessus.  Treatment with Sulforphane of such macrophages  significantly decreased bacterial burden (R).

Sulforaphane Combats Inflammation

Nuclear Factor Kappa-B (NF-kB) is a well known driver of inflammation. Sulforaphane greatly decreases NF-kB activity (R).

As previously mention, Sulforaphane very strongly activates Nrf2, which lowers inflammation (RR).

Sulforaphane May Combat Depression and Anxiety


Inflammation has been recognized as one of the causes of depression. By reducing inflammation, sulforaphane can help combat depression.

Repeated SFN administration reverses depression– and anxiety-like behaviors in chronically stressed mice, likely by inhibiting the hypothalamic-pituitary-adrenal (HPA) axis and inflammatory responses to stress (RR).

In another study, it was shown that Nrf2 deficiency in mice results in depressive-like behavior, while the induction of Nrf2 by sulforaphane has antidepressant-like effects (R).

Also, dietary intake of glucoraphanin during the juvenile and adolescent periods in mice prevents the onset of depression-like behaviors at adulthood (R).

Sulforaphane Protects the Brain and Restores Cognitive Function

Sulforaphane increases neuronal BDNF in mice, a factor that supports the survival of existing neurons and encourages the formation of new neurons and synapses (R).

SFN reduces brain inflammation in various animal models of pathogen-induced neuroinflammation and neurodegenerative disease (RRRR).

Sulforaphane promotes microglia differentiation from pro-inflammatory M1 to anti-inflammatory M2 state. This reduces brain inflammation and restores spatial learning and coordination in rats (R).

Sulforaphane is beneficial in various pathological conditions:

  • SFN improves cognitive performance and reduces working memory dysfunction in rats after traumatic brain injury (R).
  • SFN attenuates cognitive deficits in mouse models of psychiatric disease. Also, the intake of glucoraphanin during the juvenile and adolescent periods prevents the onset of cognitive deficits at adulthood (R).
  • SFN alleviates brain swelling in rats, by attenuating the blood-brain barrier disruption, decreasing the levels of pro-inflammatory cytokines, and inhibiting NF-κB (R). SFN also increases AQP4 (a water channel protein) levels, thereby reducing brain swelling (R).
  • SFN prevents memory impairment and increases the survival of hippocampal neurons in diabetic rats (R).

Sulforaphane recovers memory in mice and rats with chemically induced memory impairment (RR R).

SFN exerts positive effects against brain damage induced by acute COpoisoning in rats (R).

Sulforaphane protects human neurons against prion-mediated neurotoxicity (R).

Insufficient NRF2 activation in humans has been linked to neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease and amyotrophic lateral sclerosis (R). SFN, as a potent Nrf2 activator, may help in the treatment of these diseases.

Sulforaphane Improves Symptoms of  Autism

Sulforaphane activates several genes that lower inflammation and protect cells from oxidative stress and DNA damage, which are much higher in those with Autism (R).

In a clinical trial of 29 young men with  moderate to severe autism (age 13-27), Sulforphane treatment over 13 weeks resulted in a 35% improvement in disruptive behavior(R).

Sulforaphane relieves Gastrointestinal inflammation, colitis, and ulcers

Aspirin and NSAID’s are very effective at relieving pain, but can damage stomach lining and even cause ulcers.  Sulforaphane has been shown to protect agains such damage in mice (RR,R).

Sulforaphane has also been shown to increase Nrf2 and decrease inflammation in mice with colitis (R,R).

Sulforaphane May be Beneficial in Airway Inflammation and Asthma

Sulforaphane received airway inflammation and asthma symptoms in mice  (R)

Broccoli sprout extract  relieved airway inflammation in humans exposed to vehicle exhaust levels similar to those on a Los Angeles freeway (R).

But in other studies,  broccoli sprouts did not alleviate symptoms of asthma (R),  COPD (R) or ozone-induced airway inflammation (R).

Sulforaphane Can Be Beneficial in Arthritis

We previously pointed out that Sulforaphane strongly activates Nrf2, which relieves inflammation in many conditions.  In additions, sulforaphane was found to inhibit metalloproteinases that cause osteoarthritis and cartilage destruction (R).

Sulforaphane also decreases inflammatory cytokines, reducing symptoms of arthritis in mice (R).

Sulforaphane Protects the Eyes

Sulforaphane protects photoreceptor cells from excessive light exposure damage  (R) and  degeneration (R) in humans, and light-induced retinal damage in mice (R).

Sulforaphane protects human retinal cells and delays onset of cataracts (R), and helps prevent complications after cataract surgery (R).

In mice, sulforaphane helped maintain vitamin A and C levels in retinal cells to prevent damage from oxidative stress (RRR).

Negative Side Effects

Possible liver Toxicity at extreme dosages

There has been a single report of liver toxicity in one individual that consumed over 800 ml per day of broccoli juice for 4 weeks, but function returned to normal wishing 15 days or discontinuing the juice (R).

Note this individual was making juice from mature broccoli plants which have many different active substance and are not recommended for source of glucoraphanin/sulforaphane as the young sprouts have up to 100 times higher glucoraphanin levels.

Maximizing Bioavailability

Glucoraphanin Sources

Broccoli has the highest amounts of glucoraphanin of any vegetable, but it is also found in Brussel sprouts, Kale, Cabbage, Bok Choy, and several others (R).

As previously mentioned, young broccoli sprouts have up to 100 times more glucoraphanin than mature broccoli, making them ideal sources if you want to grow or purchase them (RR).

Myrosinase also required

Remember, Sulforaphane is only formed when it comes in contact with the enzyme myrosinase, by chewing or chopping or other processing.

Myrosinase is a fragile enzyme that is quickly damaged by heating (boiling over 1 minute), or freezing (R).

Many Supplements do not provide active Myrosinase

Broccoli has long been known to provide many health benefits and as such, broccoli sprout supplements are not new to the market.  Unfortunately, many of these were developed before researchers realized the Myrosinase + Glucoraphanain = Sulforaphanin  equation required great care in processing to protect the Myrosinase.

As a result, most broccoli supplements do not provide ANY active myrosinase  (RR).

Sulforaphane was found to be 7 times greater in fresh broccoli sprouts vs supplements with inactive myrosinase  (R).

Glucoraphanin powder with inactive tyrosinase can be combined with a good source of tyrosinase such as broccoli sprouts or mustard seeds to greatly increase Sulforaphane absorption (R).

Mustard seed

The myrosinase found in broccoli is quite fragile and inactivated by freezing or heat. A much more robust form of myrosinase  is found in Mustard seeds. The addition of powdered mustard seed to heat processed broccoli dramatically increases sulforphane (R).

WHAT WE RECOMMEND

We’ve looked at all the leading brands sold on Amazon. There are several that are good, and many that are garbage. The best quality we found is this one by Avmacol.


 

Sulforaphane activates genes and enzymes that stimulate antioxidant production:

  • inhibits Phase I enzymes CYP1A1, CYP1A2, CYP1B1, CYP2B2 and CYP3A4 (RR).
  • activates (RR). SFN reacts with Keap1, thereby releasing Nrf2 from Keap1 binding (R).
  • increases other Phase II enzymes: NQO1, GSTA1, and HO-1 (RRRR).
  • blocks SXR (R).

Sulforaphane inhibits inflammation:

  • inhibits NfkB (RRR).
  • inhibits TNF-α (RR), NLRP3, IL-1β, IL-18 (R), IFN-gamma and IL6 (RRR).
  • inhibits IL-17 (RR).
  • inhibits TGF-β/Smad (R).
  • increases IL-10 (RRR), IL-4, Arg1, and YM-1 (R).
  • inhibits NO, iNOS and COX-2 (RRR).
  • silences Th17/Th1  (RR).
  • inhibits IL-23 and IL-12 (R).
  • inhibits MMP-9 (RR).
  • inhibits LDH and PGE2 (R).

Sulforaphane changes gene expression:

  • Sulforaphane inhibits DNMT1 and DNMT3A (R)
  • SFN is one of the most potent (histone deacetylase) HDAC inhibitors found to date (R).
  • SFN inhibits HDAC1, HDAC2, HDAC3, and HDAC4 (RR).
  • SFN decreases miR-21 and TERT (R).

Sulforaphane induces cell death (apoptosis) in cancer:

  • SFN activates caspase-3, caspase-7, caspase-8, caspase-9 (RR).
  • SFN decreases anti-apoptotic Bcl-2 (R) and Bcl-XL (R).
  • SFN increases pro-apoptotic Bax (R).
  • SFN induces p21 (CDKN1A) (R) and p53 (R).
  • SFN inactivates PARP (R).
  • SFN decreases HIF1A (R).
  • SFN decreases β-catenin (CTNNB1) (R).

More on Sulforaphane and Cancer

The mechanisms of SFN effects on cancer cells have been well studied. It suppresses the proliferation of cancer cells via diverse mechanisms including cell-cycle arrest, apoptosis induction, ROS production, and manipulation of some signaling pathways (166). SFN inhibits proliferation of PC-3 cells in culture in concentrationand time-dependent manner. Singh et al. (167) showed that oral administration of SFN led to >50% reduction in PC-3 xenograft tumor volume in SFN-treated mice in 10 days and more than 70% reduction in 20 days after starting treatment with no effect on body weight.

They also reported that SFN changes the Bax: Bcl-2 ratio, activates caspases 3, 8, and 9, and cleaves and inactivates PARP protein. The authors proposed that SFN induces apoptosis in PC-3 xenograft tumors in a p53-independent manner through cytoplasmic and mitochondrial pathways. Liquid chromatography–mass spectrometry (LC-MS) analyses performed by Rose et al. (17) showed the presence of 7-methylsulphinylheptyl isothiocyanates in watercress (Rorippa nasturtium aquaticum) extract and 4-methylsulfinylbutyl nitrile and 4-methylsulfinylheptyl isothiocyanates in the broccoli extract. Their investigations showed that these compounds contribute to the inhibitory effects of broccoli and watercress extracts on the invasion of MDA-MB-231 cancer cells through suppression of MMP-9 activity.

Treatment of HEK293 cells with different concentrations of SFN with and without TSA, as a HDAC1 inhibitor, leads to the increase in TOPflash reporter activity without affecting b-catenin protein levels. Further studies showed that this increase is due to the decrease in HDAC activity and consequently the increase in histone acetylation following SFN treatment (168).

It has been demonstrated that mamosphere formation in breast cancer cells is dependent on E-cadherin expression (168). It is showed that SFN could target breast cancer stem cells. The mammosphere formation test on two cancer cell lines, MCF7 and SUM195, indicated that SFN could reduce the proportion of cell with stem cell properties, and this was further supported by ALDEFLUOR assay. In vivo examination results of SFN effects on xenograft SUM159 cells in NOD/SCID mice were consistent with the in vitro results. More importantly, cells derived from SFN-treated primary tumors could not produce secondary tumors, while cells derived from the nontreated primary tumors rapidly produced the secondary tumors in the contralateral mammary fat pad of the same mice (168).

Aldehyde dehydrogenase activity is a stem cell marker for enriching tumorigenic stem/progenitor cells (169,170). Five mmol/L of SFN led to >80% reduction of ALDH-positive SUM159 cells in vitro, and daily treatment of xenograft of SUM159 tumors with 50 mg/kg of SFN for 2 weeks led to 50% reduction in tumor size through the reduction in ALDH-positive SUM159 cells by 50%, with no effect on body weight (171). ApcMin/C mice consumed SFN in their diet have fewer tumors with lower sizes in comparison with a control group, albeit, immunohistochemical (IHC) staining revealed that the b-catenin expression was not affected by SFN consumption (172).

Furthermore, the effect of SFN treatment on selfrenewal contributing to signaling pathway, Wnt pathway, was examined by analysis of b-catenin and some other downstream genes at mRNA and/or protein levels (171).
Treatment of T24 bladder cancer cells with SFN results in induction of miR-200c expression (173).

Previous studies demonstrated that miR-200c targets the E-cadherin repressors ZEB1 and ZEB2. Ectopic expression of miR-200c resulted in upregulation of E-cadherin in cancer cells (174). Therefore, treatment of T24 cells with SNF led to E-cadherin induction and EMT suppression (173). However, it seems that these results depend upon cell type and treatment conditions. Although clinical trials seem necessary, there is a large body of investigations about anticancer effects of SFN, and the explicit point is that SFN inclusion into the diet promises a safe and confident strategy.

Another active ingredient of broccoli and other cruciferous vegetables is Indole-3-carbinol (I3C) that has anticancer effects too. Meng et al. (175,176) reported despite a somehow prohibiting effect of I3C on cell attachment in vitro, and I3C could also suppress the invasion and motility of cells. The effect of I3C on cellular metastasis was also evaluated by injecting treated cells into the tail vein of mice and tracing surface metastasis in the lung of the sacrificed animal. Their results indicated that I3C treatment reduced the metastatic capability of the cells.

Bioavailability and new biomarkers of cruciferous sprouts consumption

There are epidemiological evidences of the benefit of consuming cruciferous foods on the reduction of cancer risk (Royston & Tollefsbol, 2015), degenerative diseases (Tarozzi, et al., 2013) and the modulation of obesity-related metabolic disorders (Zhang, et al., 2016), after cruciferous intake. Cruciferous sprouts are especially rich in bioactive compounds compared to the adult plants, due to their young physiological state, being an excellent choice for consuming healthy fresh vegetables (Pérez-Balibrea, Moreno, & García-Viguera, 2011; Vale, Santos, Brito, Fernandes, Rosa, & Oliveira, 2015). The highest benefit of cruciferous foods occurs when are consumed fresh, as young sprouts, avoiding degradation of the enzyme myrosinase by cooking, which is necessary to hydrolyse their characteristic sulphur and nitrogen compounds, the glucosinolates (GLS), to the bioactive isothiocyanates (ITC) and indoles. In case of sprouts, the degradation of GLS after consumption occurs during chewing, in presence of the plant’s enzyme myrosinase, and also is mediated by β-thioglucosidases in the gut microbiota (Angelino & Jeffery, 2014).

There is growing evidences that ITC, such as sulforaphane (SFN) and sulforaphene (SFE), as well as the indole-3-carbinol (I3C), play antioxidant, anti-inflammatory and multi-faceted anticarcinogenic activities in cells (Stefanson & Bakovic, 2014), through the in vivo inhibition of the activation of the central factor of inflammation NF-κB (Egner, et al., 2011), and the induction of the Keap1/Nrf2/ARE pathway related with antioxidant genes and detoxifying enzymes, such as glutathione S-transferases (GST) (Baenas, Silván, Medina, de Pascual-Teresa, García-Viguera, & Moreno, 2015; Myzak, Tong, Dashwood, Dashwood, & Ho, 2007), and also blocking carcinogenic stages in vitro and in vivo by induction of apoptosis, cell cycle arrest and inhibition of histone deacetylases, among others finally, metabolised in the liver with N-acetyl-L-cysteine (-NAC). During the last years, some conjugated ITC, such as SFN-NAC, and other secondary compounds, such as 3,3’diindolylmethane (DIM), which is released by I3C in acid medium (i.e. the stomach), have been used as biomarkers of cruciferous intake (Angelino & Jeffery, 2014; Fujioka, et al., 2016a). However, the bioavailability of the GLS glucoraphenin (GRE) and its isothiocyanate SFE, from radish sprouts, which only differ from SFN in a double bond between the third and fourth carbon (see Figure 2 in section 3), have not been yet investigated.

To our concern, there are no publications studying the bioavailability of radish sprouts compounds, and it is unknown if SFE is metabolised also by the mercapturic acid pathway. Furthermore, there are no commercially available conjugated metabolites of SFE, which would be needed for study its bioavailability by a rapid and sensitive UHPLC-QqQ-MS/MS method, stablishing their appropriate ionization conditions and MRM transitions.

On the other hand, the presence of SFN has been described in radish (Pocasap, Weerapreeyakul, & Barusrux, 2013), maybe by the hydrolysis of GRE, or through a modification of SFE once formed to SFN, suggesting its possible transformation by the mercapturic acid pathway. Therefore, the aim of this study was to evaluate and compare the bioavailability and metabolism of GRA and GRE, from broccoli and radish sprouts, respectively, and the study of possible different biomarker profiles of broccoli and radish consumption for the first time. Also the urine profile evolution of ITC, indoles and conjugated metabolites, after consumption of both broccoli and radish sprouts, were evaluated in a 7 days-cross-over trial with 14 healthy adult women.

2. Material and methods
2.1. Plant material
Broccoli (Brassica oleracea var. italica) and radish (Raphanus sativus cv. Rambo) 8-day-old sprouts were supplied by Aquaporins & Ingredients, S.L. (Murcia, Spain). These sprouts were bioestimulated during production (4 days previous to delivery) with the natural compound methyl jasmonate 250 μM (Baenas, Villaño, García-Viguera, & Moreno, 2016), in order to obtain cruciferous sprouts up to 2-fold richer in bioactive compounds. Three trays of sprouts

(n=3) were collected once a week during the study, then, samples were flash frozen and lyophilised prior analysis of GLS and ITC (see 2.3. section), through an hydro-methanolic (Baenas, Garcia-Viguera, & Moreno, 2014) and aqueous extraction (Cramer & Jeffery, 2011), respectively, as previously described.

2.2. Human subjects and study design. 

A total of 14 women, aged 27-36 years, non-smokers with stable food habits and not receiving medication, during the experimental procedure, were selected to participate in the study. Due to the sex-related disparities in pharmacokinetics and bioavailability results reported by different authors (Soldin, Chung, & Mattison, 2011; Soldin & Mattison, 2009), the choice of a single genus was chosen to avoid a high dispersion in the data, and the availability of healthy young adult female volunteers for the study. Written informed consent was obtained from all subjects. The present study was conducted according to guidelines and procedures approved by the CSIC Committee of Bioethics for the AGL-2013-46247-P project. Subjects were randomly assigned to a seven-by-seven cross-over design (Figure 1), one group receiving broccoli sprouts and the second receiving radish sprouts. Nobody dropped out of the study. A list of foods containing glucosinolates was given to all the participants in order to avoid consumption during the study. Experimental doses (7 trays of broccoli or radish sprouts of 20 grams each) were given at once, on Friday. Subjects were instructed to ingest 1 tray per day, at 10 a.m., according to the cross- over design and to keep trays refrigerated (4 °C) at home. The first day of the study, the urine samples were collected from 0 to 12 h, and from 12 to 24 h after ingestion. From day 2 to 7, the urine samples were collected in 24 h periods. All urine samples were kept refrigerated during collection and were frozen upon reception in the laboratory.

2.3. Metabolites analysis 

The quantitative analysis of GLS in sprouts was carried out by HPLC-DAD 1260 Infinity Series (Agilent Technologies, Waldbronn, Germany), according to UV spectra, and order of elution already described for similar acquisition conditions (Baenas, et al., 2014). For samples preparation, briefly, freeze-dried sprouts (50 mg) were extracted with 1mL of methanol 70% V/V in a US bath for 10 min, then heated at 70°C for 30 min in a heating bath and centrifuged (17500 xg, 15min, 4°C). Supernatants were collected, and methanol was completely removed using a rotary evaporator. The dry material obtained was dissolved in 1 mL of ultrapure water and filtered through a 0.22 μm Millex-HV13 filter (Millipore, Billerica, MA, USA). Measurement of metabolites in sprouts and urine (GRA, SFN, SFN-GSH, SFN-CYS, SFN- NAC) was performed following their MRM transition by a rapid, sensitive and high throughput UHPLC-QqQ-MS/MS (Agilent Technologies, Waldbronn, Germany) method, with modifications of the protocol of Dominguez-Perles et al. (2014), for the optimization of new compounds: GRE, SFE, glucobrassicin (GB), I3C, DIM; assigning their retention times, MS fragmentation energy parameters and preferential transitions (Supplemental File 1). The urine samples were centrifuged (11,000g, 5 min) and the supernatants (400 μL) were extracted using SPE Strata-X cartridges (33u Polymeric Strong Cation), following the manufacturer’s instructions (Phenomenex, Inc., Madrid, Spain), and the slight modifications of Dominguez- Perles et al., (2014). Briefly, the cartridges were conditioned and then aspirated until dryness. The target analytes were eluted with 1 mL of MeOH/formic acid (98:2, v/v) and dried completely using a SpeedVac concentrator (Savant SPD121P; Thermo Scientific, Waltham, MA). The extracts were reconstituted with 200 μL of mobile phase solvent A/B (90:10, v/v) previously to their UHPLC/MS/MS analyses. GRA and GRE were obtained from Phytoplan (Diehm & Neuberger GmbH, Heidelberg, Germany) and ITC and indoles were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). No commercially available conjugated metabolites of SFE from radish were found.

2.4. Statistical analysis 

All assays were conducted in triplicate. Data were processed using SPSS 15.0 software package (LEAD Technologies Inc., Chicago, IL, USA). First of all, data were tested by Shapiro-wilk normality test, as these values do not follow a normal distribution (non-parametric data), statistical differences were determined by the Wilcoxon signed-rank test when comparing two samples and by the Friedman test when comparing multiple samples. Values of P<0.05 were considered significant.

3. Results and discussion
3.1. Bioactive compounds present in cruciferous sprouts
Broccoli and radish sprouts from each week of the study were characterised in GLS and ITC (Table 1). Results are presented as commercial serving dose (20 grams of fresh weight (F.W.)). The amount of cruciferous sprouts consumed daily by the participants was considered a normal serving according to the EFSA (2009), which consider that there is no a perfect way of measuring habitual intake, however, the portion size should be convenient for the use in the context of regular dietary habits.
In broccoli sprouts, glucoraphanin (GRA), in the hydromethanolic extract, and its hydrolysis compound sulforaphane (SFN), in the aqueous extract were the predominant compounds, according to previous findings (Angelino & Jeffery, 2014; Cramer & Jeffery, 2011).
Results showed that radish sprouts presented glucoraphenin (GRE) and glucoraphasatin (GPH) as predominant GLS (Table 1), which were hydrolysed to sulforaphene (SFE) and raphasatin (RPS), respectively. Only SFE was detected in the aqueous extract, as RPS is very unstable and rapidly degraded to less bioactive compounds in aqueous media, such as raphanusanins, E- and Z-3-methylsulfanylmethylene-2-pyrrolidinethiones and E-4-methylsulfanyl-3- butenyldithiocarbamate (Kim, Kim, & Lim, 2015; Montaut, Barillari, Iori, & Rollin, 2010). GRA was not detected in radish sprouts, but the hydrolysis product SFN was present in the aqueous extract (Pocasap, et al., 2013). This could be due to the formation of SFN derived from SFE, losing its double bond, or directly hydrolysed from GRE (Figure 2). Forthcoming evaluations of GRE hydrolysis under different conditions would provide more information about its possible transformations.

3.2. Bioavailability and metabolism of GLS/ITC 

After ingestion of a serving portion of broccoli sprouts (20 g F.W.), GRA (64 μmol) was hydrolysed, absorbed and metabolised, through the mercapturic acid pathway, by a 12 % on average. SFN and its conjugated metabolites, with glutathione (-GSH), cysteine (-CYS) and N- acetyl-L-cysteine (-NAC) (Angelino & Jeffery, 2014), were found in urine (~7.6 μmol/ 24 h as the sum of SFN, SFN-GSH, SFN-CYS and SFN-NAC) (Figure 3A), considered markers of bioavailability.

In the case of radish sprouts, the metabolism of SFE, the predominant ITC, has not been described to the present date, and there are not any conjugated SFE metabolites commercially available to evaluate its bioavailability, by optimization of MRM-transitions in UHPLC-QqQ- MS/MS system. Therefore, it was hypothesised that conjugated SFN metabolites could be found also in urine after radish sprouts consumption, being also possible biomarkers of intake.

Results showed that GRE (61 μmol in 20 g F.W.) was metabolised in SFE, SFN and SFN metabolites (SFN-NAC, SFN-CYS, SFN-GSH), corresponding to 8% on average (~4.9 μmol/24 h) of the GRE consumed (Figure 3B). Therefore, SFN metabolites (SFN-NAC, SFN- CYS, SFN-GSH) could act also as biomarkers of radish consumption. In this sense, this analysis method allowed us to evaluate radish compounds bioavailability, in addition to differentiate it from the bioactives in broccoli, as well as other cruciferous foods, finding intact SFE metabolite as characteristic biomarker of radish consumption.

The values of bioavailability ranged from 9 to 100 % according to different GLS/ITC profiles of the cruciferous vegetables administered, and the consumption as raw or cooked foods and the influence of the microbiota (Shapiro, Fahey, Wade, Stephenson, & Talalay, 1998; Vermeulen, Klopping-Ketelaars, van den Berg, & V aes, 2008). In our case, after broccoli sprouts consumption, the SFN-NAC was the predominant metabolite found in urine (~80 %), followed by SFN-CYS (~11 %), SFN (7.5 %), and SFN-GSH (~0.9 %) (Figure 3A), as previously found (Clarke, et al., 2011; Dominguez-Perles, et al., 2014). In the case of radish sprouts, the SFE was excreted in higher amounts (~65 %) (Figure 3B), followed by the conjugated metabolites: SFN- NAC (~19 %), SFN-CYS (~4%), SFN (~1.1%) and SFN-GSH (~0.7%). SFN and SFE present the isothiocyanate group (−N=C=S), which central carbon is highly electrophilic and actively interacts with cellular nucleophilic targets; such as, the GSH and/or cysteine residues (Kim, Kim, & Lim, 2010). Little information is available about SFE bioactivity and, only recently, Byun, et al., (2016) showed that SFE reduced the cellular GSH levels in vitro, which could indicate its conjugation with GSH. Thus, the synthesis of SFE conjugates with GSH, CYS or NAC could help to generate knowledge on the metabolism of this compound.

On the other hand, the higher excretion of pure SFE after radish consumption compared to pure SFN after broccoli ingestion, may suggest that this compound could follow a different transformation pathway. Contrary to SFN, SFE contains a double bond between the third and fourth carbon, which could result in a decrease in the electrophilicity of the –N=C=S group (Kim, et al., 2010), and different excretion kinetics and transformation.

According to Holst & Williamson (2004), human studies about Phase I metabolism may contribute considerably to understand the biotransformation of ITC and, consequently, the limit of their bioavailability and health-promoting effects. Therefore, further studies about SFE metabolism and bioactivity are needed to support the health-promoting activities of SFE, now insufficiently studied. For instance, Myzak, et al, (2006) showed differences in the bioactivity of SFN conjugated metabolites, as being SFN-CYS and SFN-NAC, significantly active as HDAC inhibitors, with cancer therapeutic potential in vitro and in vivo, but not for SFN and SFN-GSH (Myzak, Ho, & Dashwood, 2006). On the other hand, pure SFN and SFE have shown bioactivities, inhibiting growth of several colon cancer cells (Byun, et al., 2016). Therefore, whether SFE is metabolised by the mercapturic acid pathway or acting in the cell without transformation, this ITC may provide health-promoting effects through induction of detoxification enzymes and antioxidant activity, which did not appear to be affected by their hydrophilicity or other structural factors (La Marca, et al., 2012).

3.3. Urine profile evolution of SFN, SFE and their metabolites. 

The values of individual metabolites excreted, analysed in urine samples, were represented according to two different criteria: 1) the levels of excretion during 24 h were normalised, first from 0 to 12 h after consumption and then from 12 to 24 h, using creatinine as an index to which refers the results, since the creatinine excretion is a relatively constant value between subjects; 2) when comparing the daily excretion during 7 days, the data were represented in volumes collected every 24 h.

The excretion of SFN and its conjugated metabolites, as well as SFE after radish sprouts ingestion was higher during the first 12 h after consumption of sprouts (Figure 4). It has been described that urinary excretion of SFN metabolites after consumption of fresh broccoli reaches peak concentration 3-6 h after consumption, but it could be delayed until 6-12 h (Vermeulen, et al., 2008). After broccoli sprouts ingestion, non-significant differences were found (Figure 4A) between the two periods. In contrast, significant differences were shown in the values of excretion after radish sprouts consumption in all metabolites except for SFN-GSH and SFN- CYS (Figure 4B). The delayed excretion of metabolites, after broccoli sprouts consumption, could be related to a saturation of the membrane transporters (such as P-glycoprotein) in the cells, as SFN is conjugated with GSH and cysteinylglycine in the cells and exported after protein binding, being available for metabolism and excretion (Hanlon, Coldham, Gielbert, Sauer, & Ioannides, 2009). SFE is mostly excreted during the first 12 h after ingestion of radish sprouts (Figure 4B), suggesting that it might be not subjected to the mercapturic acid metabolism. Nevertheless, the biological activity of the pure ITC has shown to be similar than the N -acetylcysteine conjugates (Tang, Li, Song, & Zhang, 2006), being of great interest either if are metabolised or not.

The levels of excretion after 7 days of ingestion (Supplemental files 2 and 3) were also studied and no differences were found in the median daily excretion of SFE, SFN and its metabolites in both broccoli and radish studies. This suggests that repetitive dosing of sprouts should not produce accumulation of any metabolite in the body, as any factor that increases the metabolites amount in the body will cause a decrease in its excretion (Hanlon, et al., 2009). Also, there is a high interindividual variation in excretion values related to human bioavailability studies, which could be explained by different factors, such as the intensity of chewing, where myrosinase enzymes come into contact with intact GLS, gastric pH, intestinal transporters and the activity of the microbiota, where one subject could metabolize three times more GLS into ITC than another, and also the polymorphisms of GST enzymes may affect ITC metabolism (Clarke, et al., 2011; Egner, et al., 2011; Fujioka, Fritz, Upadhyaya, Kassie, & Hecht, 2016b). Low amounts of intact GRA and GRE, on average 0.011 and 0.04 μmol/24 h, respectively, were also recovered in the urine.

One of several challenges in the design of clinical trials is the selection of the appropriate dosage. In this work, commercial trays of sprouts were used, facilitated and quality certified by the company. The average amount of sprouts (~ 20 g per tray) was chosen as one serving, representing a realistic dietary supply. Different specific dietary intervention studies have estimated that the consumption of 3-5 servings per week of cruciferous foods (broccoli, red cabbage, Brussels sprouts, among others) may produce upregulation of detoxification enzymes, responsible for clearance of chemical carcinogens and ROS (Jeffery & Araya, 2009). Therefore, the daily consumption of cruciferous sprouts may result in potential effects decreasing the risk for cancer, even though further epidemiological trials and in vivo studies testing broccoli and radish sprouts are necessary to further understand these effects.

3.4. Bioavailability, metabolism and urine profile evolution of GLS/indoles 

Glucobrassicin (GB) present in broccoli and radish sprouts is an indole GLS derived from tryptophan and releases bioactive indole-3-carbinol (I3C) upon hydrolysis. This bioactive compound requires acid modification in the stomach to form 3,3’-diindolylmethane (DIM) and other condensates to optimize activity, increasing levels of Phase II enzymes, related to detoxification against lung, colon and prostate cancers (Egner, et al., 2011), and the antiproliferative effects on estrogenic-sensitive tumours (Fujioka, et al., 2016a). In particular, DIM has been associated with the suppression of epigenetic alterations related to carcinogenesis, by suppression of DNA methylation and aberrant histone modifications (Fujioka, et al., 2016b).

Additionally, the induction of Phase I enzymes, including the CYP 1 family, catalysing the oxidation of xenobiotics may also be responsible of the action (Ebert, Seidel, & Lampen, 2005; Watson, Beaver, Williams, Dashwood, & Emily, 2013).
Because of the rapid hydrolysis of I3C to DIM in vivo, high stability of DIM, and the strong correlation between GB intake and the amount of DIM excreted, this compound has been described as a biomarker of cruciferous vegetables consumption (Fujioka, et al., 2014). Other condensated compounds such as indol-[3,2-b]-carbazole and related oligomers, were in non- quantifiable concentrations in other studies (Reed, et al., 2006).

Little is known about the bioavailability of other indole GLS present in broccoli and radish sprouts, such as hydroxyglucobrassicin (HGB), methoxyglucobrassicin (METGB) and neoglucobrassicin (NEOGB), which might be also hydrolysed leading indolyl-3-methyl isothiocyanates, unstable and hydrolysed to their corresponding carbinols (Agerbirk, De Vos, Kim, & Jander, 2008; Hanley & Parsley, 1990).

Additional studies are required to confirm if these indole GLS could be hydrolysed also in I3C and DIM, as well as to evaluate the possible health-promoting effects of their hydrolysis and condensate metabolites.
Results demonstrated that broccoli and radish sprouts content in GB were ~11.4 and ~7.7 μmol/20 g F.W, respectively. After ingestion of broccoli sprouts, 49 % of GB was suitably metabolised and excreted as hydrolysis metabolites, calculated as the sum of I3C and DIM (~5.57 μmol /24 h). Following radish ingestion, the percentage of GB hydrolysed and absorbed was 38 % (~2.92 μmol /24 h). It is remarkable that the DIM excreted correspond to over 99 % of these total metabolites. These results of bioavailability contrast with the extremely low percentage (< 1 %) of GB excreted as DIM after consumption of Brussels sprouts and cabbage in a previous study (Fujioka, et al., 2014). Nevertheless, results show relevant bioavailability of GB and the successful use of DIM as biomarker of cruciferous intake. Further studies about conversion of other indole GLS to I3C and DIM are needed to know more about bioavailability of these compounds, as there is no information in literature.

When urine samples were collected in two periods after the ingestion of the sprouts, higher values of excretion of I3C from 12 to 24 h than from the first period were detected (Figure 5), although non-statistically different. Regarding excretion values of DIM, no differences among results were found from 0 to 12 h and from 12 to 24 h (Figure 5). Even if a previous study in humans has shown that the majority of DIM was excreted in the first 12 h (Fujioka, et al., 2016b), other authors have detected DIM in plasma at 12 and 24 h post ingestion (Reed, et al., 2006). Therefore, the excretion of this compound might be longer than for the ITC, which were almost totally excreted during the first 12 h. According to these results, in vivo evidences show that I3C condensation products were absorbed, preferentially targeting the liver, and were detected within the first hour in urine. However, the amount increased significantly between 12 and 72 h, implying effects on the xenobiotic metabolism (WHO, 2004).

No statistical differences were found in the 24 h urine excretion values of I3C and DIM after 7- days of consumption of sprouts (Supplemental File 3). The high variability between subjects has been described before within a low dose level of GB consumed (50 μmol), which was considerably higher than in this study (Fujioka, et al., 2016a).

Furthermore, the results showed no accumulation of metabolites after 7 days of intervention, an important result for safe consumption, also proven with hyper-doses of GB (400-500 μmol) in humans (Fujioka, et al., 2016a).
Low amounts of intact GB (~0.011 and ~0.04 μmol/24 h, after broccoli and radish ingestion, respectively) were also recovered in the urine, but the biological activities of I3C, administered orally to humans, cannot be attributed to the parental compound but rather to DIM and other oligomeric derivatives (Reed, et al., 2006). Therefore, the evaluation of DIM in urine after broccoli and radish consumption provided a susceptible tool to design future clinical trials.

4. Conclusions 

The measurement of ITC, indoles and conjugated metabolites are useful biomarkers of dietary exposure to cruciferous foods. The SFN-NAC is not the only metabolite present in urine and, as along with DIM, could be used as biomarker of the consumption of cruciferous vegetables.

After ingestion of radish sprouts, SFE, together with SFN-NAC and DIM, could be considered as biomarkers, however, metabolites of SFE are not commercially available yet and, consequently, understudied. Repeated dosing of sprouts does not lead to accumulation or higher urine levels of metabolites over time. Furthermore, human short-term pharmacokinetics (e.g. 48 – 72 h) as well as long-term intervention studies (e.g. 10 – 12- weeks) using different doses, and collecting urine and plasma (several time points), as well as faecal samples (microbial metabolites and potential beneficial changes in the gut/colonic microbiota), are strongly recommended for future research in this area.

Transplanted Stem Cells Can Restore Fertility In Mice

Germline stem cells from infant mice can restore fertility in sterilised adult mice

Finding ways to restore fertility could help many individuals which have become sterile as a result of cancer treatments, in addition to those suffering from an earlier menopause. It also has the potential to treat the menopause itself and replenish hormone production In pursuit of this, various scientists have been studying the potential of germline stem cells, which are able to produce egg cells as mammals develop. Researchers have succeeded in producing eggs cells in the laboratory, but thus far it’s unclear whether this process might happen naturally in the body following transplantation.

 “The argument is whether these cells will do it in the body normally, or is this a feature of the cells being cultured”

Hopeful results

To determine whether these stem cells might be able to differentiate into eggs cells within the body, a team at Shanghai Jiao Tong University have successfully transferred germline stem cells from the ovaries of 6-day-old mice into sterilised adult mice. To the researchers’ delight, these cells migrated to a new position in the adult ovaries and became eggs cells. Furthermore, around 5 to 8 weeks after transplantation when these mice were mated 6 of the 8 treated mice became pregnant and delivered healthy offspring.

This study is an excellent proof of concept, but it does pose some remaining questions. As the stem cells were sourced from young mice, this approach is not readily applicable to humans. If we are able to find these cells in adults, or perhaps reprogram other cells to become germline stem cells, this may prove a viable strategy in the future. We’ll need to conduct more research on the topic, and translate to humans before we have a good indication of success.

Read more Science News

NMNAT: It’s an NAD+ synthase, chaperone, AND neuroprotector

Nicotinamide mononucleotide adenylyl transferases (NMNATs) are a family of highly conserved proteins indispensable for cellular homeostasis. NMNATs are classically known for their enzymatic function of catalyzing NAD+ synthesis, but also have gained a reputation as essential neuronal maintenance factors. NMNAT deficiency has been associated with various human diseases with pronounced consequences on neural tissues, underscoring the importance of the neuronal maintenance and protective roles of these proteins.

New mechanistic studies have challenged the role of NMNAT-catalyzed NAD+ production in delaying Wallerian degeneration and have specified new mechanisms of NMNAT’s chaperone function critical for neuronal health. Progress in understanding the regulation of NMNAT has uncovered a neuronal stress response with great therapeutic promise for treating various neurodegenerative conditions under question [3]. Given the essential role for NAD+ in cellular metabolism, it is not surprising that the enzyme is required for the survival of all living organisms, from archaebacteria to humans.

The discovery of the remarkable neuroprotective function of NMNAT pro- teins sparked a burst of investigations on NMNAT in the nervous system. More recently, NMNAT mutations have been identified to cause a severe form of retinal degener- ation and NMNAT deficiency has been associated with complex neurological diseases. In this review, we focus on the function of NMNAT in the nervous system and discuss the recent advances in understanding the regulatory mechanisms of neuronal maintenance that are relevant for neuroprotective therapies against neuro- degenerative conditions. For previously published reviews that focus on the neuroprotective effects of NMNAT, particularly in axon degeneration and injury, we refer readers to [1,4–6].

Genetic links between NMNAT and diseases of the nervous system
The only known monogenetic disease associated with NMNAT proteins is Leber congenital amaurosis (LCA), one of the most common forms of inherited blindness in children. Compound heterozygous or homozygous muta- tions in NMNAT1 cause LCA9 (OMIM 608553), an auto- somal recessive condition characterized by severe early- onset and rapid progression of vision loss and retinal degeneration [7]. To date more than 30 mutations spread across the NMNAT1 gene have been reported, including missense, nonsense, and splicing mutations (Figure 1) [8–11]. Importantly, most LCA9 patients have reported normal physical and mental health, suggesting a specific requirement of NMNAT1 for maintenance of the neural tissue in the retina [9].

So far no human diseases have been shown to be directly caused by mutations in NMNAT2 or NMNAT3, though several studies have signified a putative contribution of NMNAT deficiency to the progression of complex neu- rological diseases. Microarray studies have shown that NMNAT2 mRNA levels are reduced in various neurode- generative diseases, including Alzheimer’s disease (AD), Parkinson’s disease, and Huntington’s disease [12–14]. In AD, NMNAT2 transcript levels negatively correlate with cognitive dysfunction and AD pathology [15 ]. Genome- wide association studies have indicated a SNP (rs952797) located 126 kb downstream of the NMNAT3 gene that is associated with late-onset AD [16]. Although these asso- ciation studies do not demonstrate a causal relationship,

 

Introduction

Humans have three NMNAT genes that produce three NMNAT protein isoforms with distinct tissue expression patterns and subcellular localizations [1]. NMNAT1 is ubiquitously expressed and is enriched in the nucleus. NMNAT2 is predominantly expressed in the brain and is localized to the cytosol and enriched in membrane com- partments. NMNAT3 is also widely expressed but is highest in liver, heart, skeletal muscles, and red blood cells [2]. NMNAT3 is reported to have two splice variants, encoding mitochondrial localized FKSG76 and cytosolic NMNAT3v1, though the expression and function of these endogenous protein variants are still they do recommend NMNAT as an important contributor to neuronal health.

Molecular functions of NMNAT necessary for neuronal maintenance and protection 

LCA9 and other neurological disease phenotypes associ- ated with NMNAT deficiency are consistent with its neural maintenance function, yet the neuroprotective capacity of NMNAT had already emerged with the serendipitous discovery of the slow Wallerian degenera- tion mutant (Wlds) mouse [17,18]. In the Wlds mouse, degeneration of the distal axon following axotomy (Wallerian degeneration) is remarkably delayed by a dominant mutation causing overexpression and redistri- bution of Nmnat1 to the cytoplasmic compartment of the axon [4]. The neuroprotective role of NMNAT is effica- cious against not only axonal injury, but also models of various neurodegenerative conditions such as toxic neuropathy, glaucoma, spinocerebellar ataxia, tauopathy, and Huntington’s disease [1,5,19–25]. Furthermore, NMNAT homologues across species, including archae- bacteria, yeast, fly, mouse, and human, exhibit a conserved cytoprotective function, even when expressed in different model organisms [1,19]. While these studies chronicle the potent and conserved protection NMNAT proteins confer against a variety of neuronal insults, the precise mechanism by which NMNAT engenders this protection has been hard to pinpoint.

NMNAT proteins have two distinct functions that can bestow neuronal maintenance and protection: NAD synthase activity and chaperone activity [26]. NMNAT catalyzes the reversible conversion of NMN (nicotin- amide mononucleotide) to NAD+ in the final step of both the de novo biosynthesis and salvage pathways. NAD+ is a vital coenzyme important for metabolism and redox biology, as well as a substrate in multiple signaling processes [27]. Thus, NMNAT enzymes play a straight- forward role in neuronal maintenance via balancing NAD+ consumption with production. A molecular chap- erone function has also been demonstrated by a number of NMNAT proteins tested, including Drosophila Nmnat, mouse Nmnat2, and human NMNAT3 [15,19,28]. In vitro these NMNAT proteins bind to client proteins and prevent thermal-stress induced unfolding [15,19]. Thus, NMNAT chaperones can contribute to neuronal protein homeostasis.

There is still considerable controversy surrounding the mechanism of NMNAT-mediated neuroprotection. The prevailing hypothesis is that NMNAT overexpression pro- vides continuous enzyme activity in injured neurons, thus preventing the consequent decrease in NAD+ and the accumulation of the precursor NMN [6]. However, recent work revealed that NAD+ depletion following axon injury is due to a dramatic increase in consumption by the pro- degenerative SARM1 (sterile alpha and TIR motif-con- taining 1), but that overexpression of cytoplasmic Nmnat1 blocks SARM1-dependent NAD+ consumption without increasing NAD+ synthesis [29 ]. Thus, NMNAT-medi- ated axon protection hinges on its ability to block pro- degenerative SARM1 signaling, but this does not rely on enzymatic conversion of NMN to NAD+. One alternative is that NMNAT provides neuroprotection via an enzyme- independent function, leading to the hypothesis that NMNAT mediated protection is chaperone-dependent. Recently, it has been shown that Nmnat2’s enzyme activity is dispensable for relieving the toxic phosphorylated tau burden in a model of fronto-temporal dementia and parkinsonism 17 (FTDP-17), and that Nmnat2 complexes with the classical HSP90 chaperone, possibly to promote refolding of toxic tau [15 ]. In another study, overexpres- sion of cytoplasmic Nmnat1 partially preserved neuronal function in a model of early-onset FTDP-17 by decreasing insoluble tau aggregates, without altering phosphorylated tau [30]. Similarly, overexpression of yeast homologs of NMNAT, NMA1 and NMA2, suppresses proteotoxicity in yeast models of polyglutamine- and a-synuclein-induced neurodegeneration also by enhancing clearance of mis- folded proteins [22].

Though the precise mechanism may vary by disease model, it is clear that NMNAT over- expression alleviates proteotoxic stress in neurodegenera- tive conditions associated with protein misfolding, consis- tent with a chaperone function. Further supporting the chaperone function of NMNAT is the identification of its endogenous ‘client’ protein in Drosophila synapses, where Nmnat maintains active zone structure by directly interacting with the active zone protein Bruchpilot (BRP) in an activity-dependent manner [28]. Perhaps a source of resistance to this hypothesis is that enzyme- inactive mouse Nmnat proteins fail to protect axons [31– 33], although enzyme-inactive Drosophila Nmnat is suffi- cient to protect against activity-induced retinal degenera- tion, Wallerian degeneration, and axonal degeneration induced by loss of JNK (c-Jun N-terminal kinase); in these conditions NMNAT chaperone-dependent protection is perhaps less implicit since here the client for such a chaperone role is not apparent [34–36]. Continued advances in NMNAT overexpression-mediated protection in neurodegenerative models will be invaluable for identi- fying not only the underlying mechanisms of NMNAT’s protection, but also by extension, the primary triggers of neurodegeneration.

Mouse models of NMNAT1-dependent LCA recapitu- late several aspects of human disease and further delin- eate disease progression; importantly, degeneration occurs after retinal development, is observed first within the photoreceptors, and is only observed in inner retinal neurons and RPE (retinal pigment epithelia) cells in advanced stages [37]. The sensitivity of the retina, there- fore, may reflect a twofold requirement of NMNAT: biosynthesis of NAD+ and chaperone activity for meeting the high metabolic and protein turnover demands of photoreceptors, respectively. Although LCA mutations are widely distributed across the NMNAT1 gene, most NMNAT1 mutant proteins characterized exhibit several common features. NAD+ synthase activity is reduced by most mutations in vitro, yet patient fibroblasts exhibit normal basal NAD+ levels, suggesting that enzyme deficiency is not a primary cause of disease [10,38 ]. Importantly, ectopic expression of several LCA9 NMNAT1 mutants is sufficient to protect cultured neu- rons from Wallerian degeneration, indicating that LCA9- causing mutations do not disrupt the qualitative neuro- protective properties of NMNAT proteins [38 ]. How- ever in vitro, NMNAT1 mutant proteins are more sus- ceptible to stress-induced unfolding compared to wild type protein, which may amplified in vivo to cause disease [38 ]. Interestingly, Drosophila photoreceptors are also particularly vulnerable to loss of Nmnat, but Nmnat’s enzyme activity is completely dispensable for mainte- nance of retinal health and function in this model [34]. So while LCA9 may be primarily attributed to a loss of NMNAT1 protein stability, more studies are needed to determine whether retinal degeneration arises from a consequential loss of NAD+ synthesis and/or loss of the molecular chaperone function (Figure 1).

Regulation of NMNAT during stress and disease
Because of the essential neuronal maintenance role of NMNAT and its capacity for neuroprotection, under- standing the regulation of NMNAT levels becomes key to unlocking its therapeutic potential. It is critical that neurons maintain sufficient levels of NMNAT2; NMNAT2 loss is considered an initiating event in Wal- lerian degeneration and also appears to be consistent in progression of neurodegenerative conditions [39]. At the protein level, NMNAT2 is constitutively degraded by the ubiquitin-proteasome system, the exact players of which are beginning to emerge. Several ubiquitin ligases, including Phr1 (Highwire in Drosophila), Skp1a, and Fbxo45, have been identified, though direct evidence of NMNAT ubiquitination is lacking [40–42]. Genetic interference of these ligases increases NMNAT levels and subsequently enhances neuronal protection. In addi- tion to protein regulation, two functional cAMP-response elements (CREs) have been identified in the Nmnat2 promoter region that influence expression at the tran- scriptional level. In an FTDP-17 tauopathy model, a pathological reduction of phospho-CREB (CRE binding protein) levels and binding with the Nmnat2 promoter resulted in decreased Nmnat2 transcript and protein [24].

 

In contrast to mammals that use three NMNAT genes to produce three different NMNAT protein isoforms, Dro- sophila has only one Nmnat gene that is alternatively spliced to generate two variants: Nmnat-RA mRNA variant encodes the nuclear Nmnat-PC protein isoform and Nmnat-RB variant encodes the cytosolic Nmnat-PD isoform. In a Drosophila model of spinocerebellar ataxia 1 (SCA1), overexpression of Nmnat-PD significantly improved behavioral and morphological defects by reduc- ing neuronal mutant human Ataxin-1 (hAtx1-[82Q]) aggregates, yet surprisingly, overexpression of Nmnat- PC increased aggregate size and exacerbated neurode- generation [43 ]. Importantly, cytoplasmic targeted Nmnat-PC is also ineffective in relieving hAtx-[82Q] proteotoxicity. This study revealed a functional diver- gence underlying Drosophila Nmnat isoform-specific neuroprotection. Therefore, alternative splicing in Dro- sophila uses one gene to produce two functionally exclu- sive mRNA variants: one housekeeping variant, Nmnat- RA, that is stably expressed under normal conditions, and one stress response variant, Nmnat-RB, that can be quickly induced under stress conditions for neuronal protection (Figure 3). Taken together with the previous finding that the transcription of Drosophila Nmnat pre- mRNA is increased under various stress conditions [44], the observation that stress also drives post-transcriptional alternative splicing to preferentially generate Nmnat-RB sheds light on the complex neuronal stress response to achieve self-protection [43 ].

Regulation of Drosophila Nmnat under neuronal stress may provide insight into regulation of NMNAT2 in mammals in neurodegenerative conditions. Notably, the transcript level of the neuroprotective Drosophila variant Nmnat-RB is reduced in late stages of models of tauopathy and SCA1, however it is increased in the early stages, suggesting an upregulation to combat pathogenic protein aggregation during disease progression that is perhaps overwhelmed at more advanced stages of neuro- nal degeneration and cell death [43 ]. Similarly, although many studies show a decrease of NMNAT2 transcript postmortem in patients with neurodegenerative diseases, there is also evidence of increased levels at the early stages of disease. For example, in mild cognitive impairment and early stages of AD, NMNAT2 mRNA levels are higher in the frontal cortex of patients exhibit- ing high levels of oxidative stress-induced neuronal DNA damage, compared to those with lower levels of DNA damage [45]; at this stage the nervous system is mounting a stress response as HSP90 is also upregulated in patient brains with high oxidative damage. In a genome-wide gene-expression study of another mouse model of FTDP- 17, Nmnat2 transcript is significantly upregulated in the hippocampus during early disease progression, but is downregulated at end stages of disease when neurofibril- lary tangle burden is heavy [46]. Here the early rise of Nmnat2 is likely a proteotoxic stress response, while the late decrease is consistent with observed downregulation of synaptic genes corresponding to synaptic loss and upregulation of inflammatory and apoptotic genes indic- ative of neuronal cell death. Since endogenous upregula- tion of NMNAT under stress conditions seems to be insufficient to maintain neural integrity in the long term, NMNAT and its transcriptional and post-transcriptional regulation can serve as a therapeutic target for pharma- cological intervention to slow the progression of neuro- degenerative diseases.

Concluding remarks

The long life of neurons, up to a century in humans, makes neuronal maintenance an important challenge. It is conceivable that compromised maintenance would result in degeneration in an age-dependent manner. The emer- gence of the chaperone function of NMNAT, an NAD+ synthase, specifically in the nervous system for neuronal maintenance, exemplifies an evolutionarily conserved

strategy of ‘repurposing’ (or ‘moonlighting’) housekeep- ing enzymes. Neurons have developed transcriptional and post-transcriptional regulatory mechanisms to bal- ance the metabolic activity and stress response role of NMNAT. Thus, understanding neuronal requirements for NMNAT the NAD+ synthase and NMNAT the chaperone under various stress and disease conditions, in addition to dissecting the regulatory mechanisms that direct the activity of NMNAT, has huge implications for neuroprotective therpapies. Furthermore, identifying druggable targets to enhance expression and/or reduce protein degradation would be a pharmacologically approachable way to achieve higher NMNAT protein levels and therefore confer neuroprotection.

Cruciferous Vegetable Intake Is Inversely Associated with Lung Cancer Risk among Current Nonsmoking Men in the Japan Public Health Center Study

Abstract

Background: Cruciferous vegetables, a rich source of isothiocyanates, have been reported to lower the risk of several types of cancer, including lung cancer. However, evidence from prospective observations of populations with a relatively high intake of cruciferous vegetables is sparse.
Objective: We investigated the association between cruciferous vegetable intake and lung cancer risk in a large-scale population-based prospective study in Japan.

Methods: We studied 82,330 participants (38,663 men; 43,667 women) aged 45–74 y without a past history of cancer. Participants were asked to respond to a validated questionnaire that included 138 food items. The association between cruciferous vegetable intake and lung cancer incidence was assessed with the use of Cox proportional hazard regression analysis to estimate HRs and 95% CIs (with adjustments for potential confounding factors).

Results: After 14.9 y of follow-up, a total of 1499 participants (1087 men; 412 women) were diagnosed with lung cancer. After deleting early-diagnosed cancer and adjusting for confounding factors, we observed a nonsignificant inverse trend between cruciferous vegetable intake and lung cancer risk in men in the highest compared with the lowest quartiles (multivariate HR: 0.85; 95% CI: 0.69, 1.06; P-trend = 0.13). Stratified analysis by smoking status revealed a significant inverse association between cruciferous vegetable intake and lung cancer risk among those who were never smokers and those who were past smokers after deleting lung cancer cases in the first 3 y of follow-up [multivariate HR for never smokers: 0.49 (95% CI: 0.27, 0.87; P-trend = 0.04); multivariate HR for past smokers: 0.59 (95% CI: 0.35, 0.99; P-trend = 0.10)]. No association was noted in men who were current smokers and women who were never smokers. Conclusion: This study suggests that cruciferous vegetable intake may be associated with a reduction in lung cancer risk among men who are currently nonsmokers. J Nutr doi: 10.3945/jn.117.247494.

Introduction

Cruciferous vegetables, including broccoli, cabbage, and radish, are a rich source of isothiocyanates, which are known for their protective effect against cancer (1). Although the mechanisms underlying their anticancer properties are not clear, they may enhance the excretion of

1 Supported by the National Cancer Research and Development Fund, Ministry of Health, Labor and Welfare, and Ministry of Agriculture, Forestry and Fisheries. 2 Author disclosures: M Inoue is a beneficiary of a financial contribution from the AXA Research Fund. N Mori, T Shimazu, S Sasazuki, M Nozue, M Mutoh, N Sawada, M Iwasaki, T Yamaji, R Takachi, A Sunami, J Ishihara, T Sobue, and S Tsugane, no conflicts of interest.

carcinogens before they damage DNA (2, 3). Cruciferous vegetable intake is associated with lowering the risk of several types of cancer, such as bladder (4–6) and colorectal cancer (7, 8).

Several prospective epidemiologic studies have considered the association between cruciferous vegetables intake and lung cancer risk (9–17). As for all cruciferous vegetables, 2 studies to our knowledge reported a significant inverse association (12, 17), but most studies reported a nonsignificant inverse asso- ciation (9, 13–16). Among all prospective studies (9–17), 2 found a significant inverse association between individual cruciferous spices, namely Chinese greens (15) and cauliflower (13), and lung cancer risk. Both cruciferous vegetables represented the highest mean intake among the cruciferous vegetables considered in the study (13, 15).

The reason for the weak inverse association may be partly explained by the little variation in the amount of cruciferous vegetables consumed. Seven of the 9 studies were conducted in Western countries (9–14, 17), where the intake of cruciferous vegetable is lower than in Asian countries. The daily intake of total cruciferous vegetables was reported as 0.2 servings (~22.6 g/d) in the United States (18); 59.8 g cabbage, Chinese leaves, and Chinese radish intake per day in Japan (19); and 121.0 g leafy, stalk, or shoot vegetables and the brassica subgroup per day in Hong Kong (20). Therefore, a stronger association may exist in Asian populations with a relatively high intake of cruciferous vegetables. However, few such prospective investigations have been conducted in Asian populations (15, 16).

Furthermore, cigarette smoking is an established risk factor of lung cancer (21), and reports from prospective studies of the association between cruciferous vegetable intake and lung cancer stratified by smoking status are limited and inconsistent (9, 15, 17).

This study was a large-scale population-based prospective study among Japanese residents with a relatively high intake of cruciferous vegetables. We aimed to clarify the association between cruciferous vegetables intake and lung cancer risk while taking smoking status into account.

Methods

Study population. The Japan Public Health Center (JPHC)10 prospec- tive study was launched between 1990 and 1993. The details of the study design have been described previously (22). The study protocol was approved by the institutional review board of the National Cancer Center, Tokyo, Japan.

The study population was defined as registered residents aged 40– 69 y of 11 public health center (PHC) areas of Japan. Ineligible subjects were first excluded because of non-Japanese nationality (n = 51), late report of emigration before the follow-up (n = 207), incorrect birthdate (n = 7), and duplicate registration (n = 10). We then excluded 1 PHC (Tokyo area) because it lacked information on cancer incidence (n = 7078). Furthermore, we excluded 2459 subjects who had died, moved out of the study area, or with whom we lost contact before the 5-y follow-up questionnaire survey.

We used the 5-y follow-up survey as the starting point because the questionnaire used in this survey provided more comprehensive infor- mation on dietary intake than the baseline survey. We included subjects who responded to the questionnaire that contained demographic data, medical history, information on smoking, and dietary intake through an FFQ. Of the remaining 130,608 participants, 98,552 responded to the questionnaire (response rate: 75.5%).

Among the 98,552 subjects, we excluded those who reported or were diagnosed with cancer before the 5-y follow-up questionnaire survey, those who left the frequency of all cruciferous vegetable intake unanswered (n = 2271), those who reported daily energy intake at the upper or lower 2.5% ends of the range (1015 and 4204 kcal for men and 865 and 3689 kcal for women, respectively; n = 4812), and those with incomplete information on smoking status (n = 5725). Finally, 82,330 participants (38,663 men; 43,667 women) were included in the analysis.

FFQ. The FFQ used in the 5-y follow-up questionnaire survey was designed to estimate the habitual dietary intake of 138 food items (including 6 cruciferous vegetables and 3 pickled cruciferous vegetables) during the previous year in standard portion sizes and 9 frequency categories. Standard portion sizes for each food item were small (50% less than the standard serving size), medium (proportional to standard serving size), and large (50% larger than the standard serving size). The 9 frequency categories for each food items were never, 1–3 times/mo, 1–2 times/wk, 3–4 times/wk, 5–6 times/wk, 1 time/d, 2–3 times/d, 4–6 times/d, and $7 times/d. Cabbage, Chinese radish, broccoli, komatsuna, Chinese leaves, pak choi, leaf mustard, and Swiss chard were categorized as cruciferous vegetables according to the grouping rules adopted in the IARC Handbooks of Cancer Prevention (19). The 3 pickled cruciferous vegetables were pickled Chinese radish, rape and leaf mustard, and Chinese leaves. Total cruciferous vegetables did not include pickled cruciferous vegetables in this study in order to make valid comparisons with previous studies (15, 16). Isoflavone intake was also estimated with the use of the FFQ to be included as a covariate because we have previously found an inverse association between isoflavone intake and lung cancer risk (23, 24). The dietary intake of each food item was calculated by multiplying frequency by standard portion and the relative portion sizes for each food item. The food intake was log-transformed and adjusted for total energy intake with the use of the residual method (25). We examined the validity of the FFQ for assessing cruciferous vegetable intake and the reproducibility of the FFQ administered at a 1-y interval (Supplemental Tables 1 and 2).

Follow-up and identification of lung cancer incidence. We followed up participants until 31 December 2012. Participants who died or relocated to other municipalities were identified annually through residential registers in each PHC area. The cause of death was confirmed with the use of mortality data from the Ministry of Health, Labor and Welfare. Among study participants, 12,345 (15.0%) died, 2992 (3.6%) moved away, and 144 (0.2%) were lost to follow-up during the study period.

Data on lung cancer incidence were obtained from local major hospitals in the respective PHC areas and data linkage with population-based cancer registries with permission from the local governments. We also used death certificate information as supplementary data. In our cancer registry system, 6.4% of lung cancer cases were obtained through death certificates only during the study period. During the 1,195,175 person-years of follow-up (median follow-up period: 14.9 y), a total of 1499 participants (1087 men; 412 women) were diagnosed with lung cancer.

The histologic types of lung cancer were coded based on the International Classification of Diseases for Oncology, 3rd edition (C34.0–C34.9) (26). The diagnosis of lung cancer was confirmed with the use of a histo- or cytologic examination in 79% of cases (n = 1187) and was based on the clinical findings or unspecified evidence in the remaining 21% of cases. Histologic type was classified as adenocarci- noma (n = 630; 42%), squamous cell carcinoma (n = 292; 19%), small cell carcinoma (n = 146; 10%), and other histologic types according to the WHO!s histologic classification of lung tumors (27).

Statistical analysis. We prospectively counted the number of person- years of follow-up for each participant from the date of completion of the 5-y follow-up questionnaire until the date of diagnosis of lung cancer, date of death, moving out of the study area, or end of follow-up (31 December 2012), whichever came first.

Cox proportional hazards regression analysis was used to calculate the sex-specific HRs and 95% CIs of lung cancer incidence according to quartile of cruciferous vegetable intake and adjusted for potential covariates. The lowest quartile of cruciferous vegetable intake was used as a reference. P values for linear trends were calculated by assigning ordinal variables for quartiles of cruciferous vegetable intake and entering the number as a continuous variable into the model. Because cigarette smoking is the most important risk factor for lung cancer, we performed a subgroup analysis by smoking status on the association between cruciferous vegetable intake and lung cancer risk. Cox proportional hazards regression analysis was repeated to calculate the HRs and 95% CIs for each smoking status. We then repeated the same analysis after excluding 189 lung cancer cases diagnosed in the first 3 y of follow-up to diminish the potential influence of participants with subclinical cancer who had modified their dietary habits. The multivar- iate model was adjusted for age, PHC area, smoking status, fruit intake, noncruciferous vegetable intake, isoflavone intake, and menopausal status in women.

Because pickled cruciferous vegetables accounted for 26% of the total cruciferous vegetable intake in our subjects, we conducted a subanalysis by including pickled cruciferous vegetable intake in total cruciferous vegetable intake as a main exposure. Further analysis was conducted on the association between the intake of specific cruciferous vegetables and lung cancer risk by smoking status in men. Multivariate HRs and 95% CIs before and after the removal of lung cancer cases diagnosed in the first 3 y of follow-up were calculated. For those cruciferous vegetables with a Spearman!s correlation coefficient of <0.1, additional analyses were performed to investigate the association between the frequency of intake and lung cancer risk. We then calculated P values with the addition of an interaction term in the multivariate model by smoking status. The reported P values are 2-sided, and P < 0.05 was defined as significant. All statistical analyses were performed with the use of SAS version 9.3 (SAS Institute).

Results

The baseline characteristics of participants! cruciferous vegeta- ble intake are shown in Table 1. Those with a higher intake of cruciferous vegetables were less likely to be current smokers, to have a higher BMI, and to have had a chest X-ray or sputum screening. A dietary intake of vegetables, fruit, and isoflavones was significantly higher in the highest quartile of cruciferous vegetable intake in both men and women.

Table 2 shows the association between cruciferous vegetable intake stratified by smoking status and lung cancer risk. Because of the small number of lung cancer cases among women who were past and current smokers, only the results for never smokers are shown. Although we observed trends of decreased cancer risk in the highest quartile among men who were never and past smokers, the association was not significant among never smokers (multivariate HR: 0.66; 95% CI: 0.39, 1.13; P-trend = 0.17) or past smokers (multivariate HR: 0.74; 95% CI: 0.49, 1.09; P-trend = 0.18). After excluding the lung cancer cases diagnosed in the first 3 y of follow-up, multivariate HRs of the highest quartile of cruciferous vegetable intake were signifi- cantly inversely associated with lung cancer risk among both never and past smokers: 0.49 (95% CI: 0.27, 0.87; P-trend = 0.04) and 0.59 (95% CI: 0.35, 0.99; P-trend = 0.10), respectively. When we combined never and past smokers, the association was still significant (multivariate HR: 0.54; 95% CI: 0.37, 0.79; P-trend = 0.007). However, no such association was observed in men who were current smokers (P-trend = 0.92) or in women who were never smokers (P-trend = 0.86). Associ- ations were virtually unchanged when pickled cruciferous vegetable intake was included in the total cruciferous vegetable intake (data not shown).

We also conducted an analysis of specific cruciferous vege- table intake and lung cancer risk by smoking status in men. To investigate the true effect of cigarette smoking, results of never and current smokers were compared (Table 3). After deleting lung cancer cases diagnosed in the first 3 y of follow-up, a significant inverse association was observed in the highest quartile of cabbage intake and lung cancer risk (multivariate HR: 0.57; 95% CI: 0.34, 0.97; P-trend = 0.04) among never smokers. No significant association was noted between other types of cruciferous vegetable intake and lung cancer risk in never or current smokers. Results were unchanged when we conducted additional analyses between the frequency of Chinese leaves, leaf mustard, and Swiss chard and lung cancer risk (data not shown).

We also conducted a likelihood ratio test to calculate P values for interactions by adding the potential confounding factors to the multivariate model. First, we tested the association between cruciferous vegetable intake and lung cancer risk among men only by smoking status (P-interaction = 0.65) and both sexes combined (P-interaction = 0.73). Second, we tested the associ- ation by sex (P-interaction = 0.13).

We further analyzed the association between cruciferous vegetable intake and lung cancer risk stratified by detection types to try to explain the observed null association in women who were never smokers. We found no association between cruciferous vegetable intake and symptom-detected lung cancer (multivariate HR: 0.97; 95% CI: 0.49, 1.89; P-trend = 0.84), whereas we observed a nonsignificant but increased risk of screening-detected lung cancer (multivariate HR: 1.21; 95% CI: 0.68, 2.14; P-trend = 0.36). In men, however, we observed a significant decreased risk of symptom-detected lung cancer (multivariate HR: 0.45; 95% CI: 0.23, 0.85; P-trend = 0.03).

Further investigation was conducted on the association between cruciferous vegetable intake and the risk of lung cancer by histologic type among women who were never smokers. Because of the small number of lung cancer cases (in men: adenocarcinoma, n = 65, 43%; squamous cell carcinoma, n = 24, 16%; and small cell carcinoma, n = 9, 6%; in women: adenocarcinoma, n = 272, 76%; squamous cell carcinoma, n = 12, 3%), only adenocarcinoma among women who were never smokers was analyzed. The multivariate HR among the highest quartile in reference to the lowest quartile was 0.98 (95% CI: 0.67, 1.44; P-trend = 0.85).

Discussion

This prospective cohort study investigated the association between cruciferous vegetable intake and lung cancer risk in a population with a relatively high intake of cruciferous vegeta- bles. We found a significant inverse association between crucif- erous vegetable intake and lung cancer risk among men who were current nonsmokers, although no significant association was observed among men who were current smokers and women who were never smokers. Similarly, an analysis of individual cruciferous vegetable intake revealed a significant association between cabbage intake and lung cancer risk among men who were never smokers. Although our study group previously found no association between total fruit and vegeta- ble intake and lung cancer risk, the association between cruciferous vegetable intake and lung cancer risk was not considered (28).

In addition to containing several bioactive components such as folate, vitamin C, tocopherols, and carotenoids (29), crucif- erous vegetables are a rich source of glucosinolates, which are catalyzed into isothiocyanates by myrosinase. Although the mechanisms underlying the anticancer properties of isothiocy- anates are not fully understood, isothiocyanates have been reported to inhibit the development of various cancers, including lung cancer in an animal model (30).

Asians, including the Japanese, have higher cruciferous vegetable intake than non-Asian populations (19, 20). Whereas

cruciferous vegetable intake is reported to be 0.2 servings/d (~22.6 g/d) in the US population (18), the intake reported in the Japanese population is much higher (59.8 g/d) (19). However, these data only include cabbage, Chinese leaves, and Chinese radish, and total cruciferous vegetable intake is expected to be higher among the Japanese. In fact, our dietary record collected from subsamples of the JPHC study indicated a mean crucifer- ous vegetable intake of 110 g/d for men and 102 g/d for women (Supplemental Table 1).

After removing subjects with early-diagnosed cancer and adjusting for confounding factors, we observed a nonsignifi- cant inverse trend between cruciferous vegetable intake and lung cancer risk in men in the highest compared with the lowest quartiles. The prevalence of smoking reported in 2000 was 51.3% in Japanese men and 27.7% in US men (31). It is likely that because of the much higher prevalence of smoking among Japanese men, we failed to observe a significant inverse association between cruciferous vegetable intake and lung cancer risk in men.

In this study, no significant association was found between cruciferous vegetable intake and lung cancer risk among men who were current smokers. Two prospective studies investigated the association between cruciferous vegetable intake and lung cancer risk among current smokers and reported inconsistent results. Whereas Lam et al. (17) reported a significant inverse association between cruciferous vegetable intake and lung cancer risk among current smokers, Wright et al. (9) found no protective association in both sexes.

 

Circulating antioxidants such as ascorbic acid, a-carotene, b-carotene, and cryptoxanthin are depleted in current smokers (32, 33), which may explain our result. Likewise, Steinmetz et al. (34) found a stronger inverse association between fruit and vegetable intake and lung cancer risk among past smokers than in current smokers. They noted that the continued presence of carcinogens derived from tobacco smoke may have overwhelmed the anticarcinogenic capacity of vegetables. In addition, the residual confounding factor of smoking might have influenced the results among current smokers.

Unlike in men, we found no significant association between cruciferous vegetable intake and lung cancer risk among women who were never smokers. One possible reason for this differ- ence could be a lack of information on secondhand smoking in women who were never smokers from the 5-y follow-up questionnaire, which may have masked the association. Addition- ally, a previous study has noted that the epidermal growth factor receptor (EGFR) gene mutation is associated with adenocarcinoma histology, never smokers, East Asian ethnicity, and women (35). Matsuo et al. (36) found that the protective effect of vegetables against non-small cell lung cancer were only present for wild-type EGFRs. The EGFR gene mutation status may explain the differ- ences found in our study because no association was found between cruciferous vegetable intake and lung cancer risk in women.

In addition, we also investigated the influence of a detection bias with regard to this difference in sex. As expected from the association between healthy behavior, including screen- ing experience and cruciferous vegetable intake, we observed an increased point estimate of screening-detected lung cancer risk in the highest quartile of cruciferous vegetable intake among women who were never smokers.

No association was found in symptom-detected lung cancer risk among women. In contrast, we did not observe an increased risk of screen- or symptom- detected lung cancer in men. These results suggest that women with higher cruciferous vegetable intake were likely to be diagnosed with lung cancer via screening. However, it is not clear why the detection bias arose only among women.

The effect of cooking (37) is important because it has been reported that raw cruciferous vegetables have a higher bioavail- ability of isothiocyanates (38, 39). We identified the amount of raw intake of the 3 most frequently consumed cruciferous vegetables, namely Chinese radish, cabbage, and Chinese leaves, with the use of 28-d dietary records of 289 subjects from the JPHC validation study (40) based on the list of menus provided by the subjects. Within that period, the proportional intake of raw cabbage, Chinese radish, and Chinese leaves (grams per day) were 26.7%, 38.4%, and 0.7%, respectively, without including pickled vegetables (N Mori, T Shimazu, S Sasazuki, M Nozue, M Mutoh, N Sawada, M Iwasaki, T Yamaji, M Inoue, R Takachi, A Sunami, J Ishihara, T Sobue, S Tsugane, unpublished data). In addition, different cruciferous species have different precursors of glucosi- nolate, which can be converted into isothiocyanates with different anticarcinogenic effects (41).

We found a significant inverse association between cabbage intake and lung cancer risk among men who were never smokers. A previous case-control study in Japan found a similar inverse association of raw cabbage intake (42). Taken together, these findings suggest that raw cabbage intake has a preventive effect on lung cancer. Future prospective research is needed to assess the effect of cooking methods or cruciferous species on lung cancer.

The strengths of this study include its prospective study design, recruitment of the general Japanese population with a high response rate to the questionnaire, and low proportion of follow-up loss. However, several limitations should be noted. First, our estimation of cruciferous vegetable intake did not cover the entire intake because our FFQ only covered 6 fresh and 3 pickled cruciferous vegetables.

We examined whether the cruciferous vegetable intake estimated from the FFQ was satisfactory with the use of dietary records. Estimation from the FFQ was deemed to be satisfactory because 67% (in men) and 80% (in women) of total cruciferous vegetable was covered.

Second, dietary intake obtained with the use of an FFQ may be misclassified. Even if misclassification of cruciferous vegetable intake occurred, it may have been nondifferential and would have tended to result in an underestimation of the impact of cruciferous vegetable intake on lung cancer risk. Nevertheless, we revealed a significant inverse association between total cruciferous vegetable and cabbage intake and lung cancer risk among men who were never smokers.

Third, cruciferous vegetable intake may represent healthy eating behavior and may have cofounded the association between cruciferous vegetable intake and lung cancer risk. We therefore added fruit and other vegetable intake into the multi- variate model to investigate the independent association between cruciferous vegetable intake and lung cancer risk. We also tested whether the trend changed by adding the lung cancer screening experience into the multivariate model, but the results were virtually unchanged.

Finally, in our study there may have been a residual confounding effect of smoking (e.g., years since quitting smoking) among past smokers, as well as other remaining confounding factors such as exposure to chemical pollutants.

Further epidemiologic studies with the use of urinary isothiocyanates may be necessary because the bioavailability of isothiocyanates derived from cruciferous vegetables depend on the cooking method (38, 39). Furthermore, a prospective cohort study on the cruciferous vegetable intake and glutathione S-transferase genotype interaction may be helpful to understand the detoxification mechanism. In conclusion, this prospective cohort study conducted in Japan demonstrated a protective association between cruciferous vegetable intake and lung cancer risk among men who were current nonsmokers.

How to use Berberine to Boost Weight Loss, Lower Blood Sugar & More

 

Berberine might just be one of the best supplements you’ve never heard of.

Elevated blood sugar levels damage the body’s tissues and organs leading to a variety of health problems, poor quality of life, and shortened lifespan.

We strongly believe a low carb diet like the Keto diet, along with increased exercise is the most effective means of combatting high blood sugar, metabolic syndrome, diabetes and related disease.

However, many people are not able to control their blood sugar levels with diet and exercise alone and turn to prescriptions medications from their doctor.

The most commonly used prescription drug for high blood sugar is metformin (Glucophage)

Works as well as Metformin
A review of the 14 most relevant studies that found berberine works as well as the most commonly prescribed diabetes drugs metformin, rosiglitazonem and glipizide (10, 11,15).

Berberine seems to work via multiple different mechanisms (12):

  • Decreases insulin resistance, so it is more effective at lowering blood sugar levels
  • Increases glycolysis inside the cells
  • Signals the liver to decrease glucose production.
  • Slows the breakdown of carbohydrates in the gut.
  • Increases the number of beneficial bacteria in the gut.

Remarkable as it seems that it acts in all these pathways, also seems to affect various other enzymes, molecules and genes related to blood sugar control.

Normalized Blood Sugar Levels
116 diabetic patients given 1 gram of berberine per day for 3 months.

These patients experienced fasting blood sugar levels lowered to normal levels, from 126 to 101 mg/dL (13).

Lowers Bad Cholesterol Levels
These same 116 patients experienced A1c levels lowered by 12% on average, and greatly lowered levels of cholesterol and triglycerides.

Triglyceride decreased from 2.51 to 1.61, total cholesterol from 5.31 to 4.35, and LDL cholesterol. from 3.23 to 2.55 mm/liter. (14).

 

Berberine has been found to work well with other interventions such as reduced calorie diets and exercise, and has synergistic effects when taking with other diabetes medications (16).

Conclusion: Berberine is very effective at lowering blood sugar level

INCREASED NAD+ AND AMPK – THE METABOLIC MASTER SWITCH

ampk enzymeWhen ingested, it travels thru the blood to cells and binds to several different molecules to actually change their function (5). This is similar to how pharmaceutical drugs work.

The different mechanisms of berberine are complicated, but one of the main functions is to activate the AMPK enzyme (6).

Referred to as a “metabolic master switch” (6), AMPk is found in the cells of the brain, muscle, kidney, heart and liver. It helps regulate metabolism (7, 8).

Berberine also affects other molecules in the cells, and is even thought to determine which genes in the cells are turned on or off (9).

This study showed the activation of AMPK resulted in increased NAD+ levels, mitochondria biogenesis, weight loss, and increased muscle fibers.

Further exploration of the mechanism that berberine and metformin utilized for elevating AMPK and NAD+ was shown in this study.

Conclusion: Berberine acts at the molecular level activating the AMPK enzyme, which increases metabolism.

Berberine and Weight Loss

weight loss chart

2 recent studies found positive results for weight loss with supplementation of Berberine.

In a 12 week long study of obese individuals that were given 500 mg of berberine 3 times a day, they lost an average of 5 pounds, and 3.6% of their body fat (17).

The second study was for 3 months, during which 37 individuals with metabolic syndrome were given 300 mg of berberine 3 times per day. These patients saw their body mass index (BMI) drop from 31.5 to 27.4, lost significant amounts of belly fat, and saw improvement in several other markers of health (18).

Improved insulin resistance and regulation of hunger hormones adiponectin and leptin were believed to be responsible for the positive results in this study.

Other studies at the molecular level have shown Berberine changes the expression of PPARgamma2 mRNA genes to inhibit formation of adipocytes (fat cells) (19, 20).

Conclusion: Studies have shown that berberine can cause significant weight loss, belly fat, improve BMI and other health markers.

 

wwrecommend

SIDE EFFECTS and DOSAGE

As fantastic as Berberine is, the main problem it has is bioavailability. One of our bodies main defense mechanisms, P-Glycoproteins, bind with foreign objects in the small intestine and carries them away.

Unfortunately it does a great job of stopping the absorption of beneficial plant based compounds like Curcumin and Berberine. The result is very low absorption rates of 5% or less, meaning we have to take a LOT more than what our bodies actually use.

Your body has to process and excrete a LOT of Berberine

Too much Berberine can lead to mild side effects such as:

  • gas
  • cramping
  • bloating

These minor discomforts appear at higher dosages only, so you should start slowly and work your way up

Also, some potential interactions with other medications:

  • Berberine is known to inhibit CYP2D6, CYP2C9, and CYP3A4, which can lead to a host of drug interactions, some of which can be serious
  • Berberine may interact with microlide antibiotics such as azithromycin and clarithromycin at hERG channels on the heart, leading to serious cardiotoxicit

Most research has used 4-500mg dosage, taken 2 -3 times a day.  Higher dosages are more effective, but tend to result in more Gastro-Intestinal issues.

Improved Bioavailability

Higher bioavailability would allow a smaller dosage to get the same effect without risk of side effects.

The product we recommend above, Protocol for Life, uses MCT oil which has been shown to increase bioavailability and avoid GI issues (21,22,23)

 

Berberine has been used for thousands of years in Chinese and Native American medicine

chinese medicineBerberine has been used for centuries in Chinese medicine and by Native American Indians, yet has only recently been “discovered” by western medicine.

With our heavy emphasis on corporate profits driven by man-made, patented medicines, we often are late in learning about natural products such as Berberine and Niagen, but rest assured you will be hearing about it more in the future.

Berberine is now being studied extensively and has been proven to lower blood sugar as well as the most commonly prescribed prescription drug metformin (1, 2), aid in weight loss, improve heart health, and several other benefits (3)

patients had improved strength, and had lower blood pressure with declining blood glucose levels

Here are just some of the things research is now proving Berberine is able to help with.

  • Significantly Lowers blood sugar levels
  • Aids in Weight Loss
  • Improves Heart Health
  • Lowers Cholesterol
  • Decrease belly fat
  • Improve Immune System
  • Anti-oxident and Anti-Inflammatory
  • Lower Blood Triglyceride levels
  • Help fight Cancer
  • Fight Depression
Conclusion: Berberine has a long history of use for an amazing array of health issues that are now being “discovered” and used by western medicine

 

What is Berberine?

Berberine is the active ingredient in a several different plants that have been used in natural remedies for centuries, such as Goldenseal (Hydrastis canadensis), Oregon grape (Berberis aquifolium), Barberry (Berberis vulgaris), and Chinese Goldthread (Coptis chinensis) (4).

An alkaloid, it has a yellow color, and has often been used as a dye.

Berberine Lowers Cholesterol and May Reduce Your Risk of Heart Disease

Heart and Stethoscope
Berberine has been shown to improve many of the factors that lead to heart disease.

This review (21) of 11 different studies show that Berberine can:

  • Lower blood triglycerides by 44 mg/dL.
  • Lower LDL (bad) cholesterol by 25 mg/dL.
  • Raise HDL (good) cholesterol by 2 mg/dL.
  • Lower total cholesterol by 24 mg/dL.

Berberine also lowers apolipoprotein B by 13-15%, which is a big risk factor for cardiovascular disease (22, 23).

Conclusion: Berberine reduces cholesterol and triglyceride levels, while raising the good HDL cholesterol, and may lower the risk of heart disease.

 

Other Health Benefits

Berberine may also have numerous other health benefits:

  • Cancer:These studies (26, 27)
    seem to indicate that Berberine plays a role in reducing the growth of different types of cancer
  • Depression: These studies with rats (24, 25, 26) show that Berberine may lessen depression
  • Infections: These studies(27, 28, 29, 30)show Berberine fights harmful bacteria, viruses, fungi and parasites
  • Antioxidant and Anti-Inflammatory: These studies (31, 32, 33) indicate Berberine has strong antioxidant and anti-inflammatory effects
Conclusion: Berberine is a strong anti-oxidant and anti-inflammatory, and may help fight depression, infections, heart disease and even cancer

 

Side Effects

thumbs upOverall, berberine is very safe with the main side effects being indigestion, and possible cramping, diarrhea, flatulence, constipation and stomach pain (10).

An average dosage used in many studies are 900 to 1500 mg per day.

Berberine has a half-life of about 4 hours, so you do need to take it more than once a day.

It is common to take 500 mg, 3 times per day.

If you have a medical condition, you should speak to your doctor before taking berberine, especially if you are taking blood sugar lowering medications.

Conclusion: Some people may experience mild side effects with Berberine. The normal recommended dosage is 500 mg 3 times per day before meals.

 

The Bottom Line

There is no such thing as a magic weight loss supplement or medication.

There are however many medications and supplements that can help.

You just need to make sure that you are using the right dose for your body.

Berberine is one of very few supplements that are as powerful as a prescription drug.

It has numerous beneficial effects, most notably blood sugar control.

It is also be useful for general health, fighing chronic disease, and anti-aging.

If you need some help controlling your weight, blood sugar levels or want to improve your heart and overall health, Berberine may be right for you.

Remember that you may need to use berberine for as long as 6+ months to get the full benefit, and dosages up to 2,000mg per day may be necessary.

 

 

 

 

 

New Study that need to be folded in to this article

Berberine protects against diet-induced obesity through regulating metabolic endotoxemia and gut hormone levels.

1. Introduction
The human gut microbiota has recently been considered an important factor in modulating body health and might be closely associated with the pathogenesis of obesity, diabetes, inflammation, cardiovascular diseases, and other diseases [1-4].
Fecal microbiota transplantations have been used in clinics for the treatment of patients with chronic gastrointestinal infections and inflammatory bowel diseases because the intestinal bacteria release certain therapeutic metabolites that suppress inflammation in the gastroenterological tract [5-7]. For energy metabolism, gut bacteria could, for instance, benefit host metabolic efficiency by producing short-chain fatty acids (SCFAs) through bacterial fermentation [8].

Importantly, the nature of the gut microbiota, such as its composition, enzyme activity, and metabolite production, can be manipulated by controllable factors, such as drugs, diet, and lifestyle, offering a possible approach to treat diseases through regulating bacterial fermentation in the intestines. We focused our research on the metabolite profile of the gut microbiota after exposure to the botanical drug berberine (Berberine, Fig. 1A), and moreover, the metabolite’s production regulation.

SCFAs are small molecular weight compounds derived from the intestinal microbiota through fermentation of the fibrous diet and could be rapidly absorbed to enter the blood and organs [9, 10]. Chemically, there are 1–6 carbon atoms in SCFAs structures, which are presented in a straight or branched conformation [11]. The beneficial bioactivity of SCFAs includes those on energy metabolism, anti-inflammation, and immune regulation [2, 12, 13]. The major SCFAs are acetate, propionate and butyrate. Among these SCFAs, butyrate, which could be readily detected in feces and blood via gas chromatography (GC), is the primary energy source and has been widely documented with regard to human health (Fig. 1A & B) [14].

Bacterial butyrate is mainly synthesized through the acetyl CoA-butyryl CoA-butyrate pathway, in which the key enzymes are regulated based on the level of ATP and NADH [15, 16]. Chemicals that interfere with the ATP production or NADH level in bacteria might in turn regulate the level of SCFAs in intestinal microbiota.

We previously reported that Berberine (Fig. 1A) could safely lower blood lipid and glucose levels, and its therapeutic efficacy has been verified in clinics [17-21]. The mechanism of Berberine is different from that of statins [17, 22] and links to its regulatory effect on cellular targets such as low-density lipoprotein receptor (LDLR) [17], insulin receptor (InsR) [23], AMP-activated protein kinase (AMPK) [24], proprotein convertase subtilisin kexin 9 (PCSK9) [25], protein tyrosine phosphatase 1B (PTP1B) [26], mitochondrial ATP production [27], and brown fat tissue [28].

Thus, Berberine is considered a multi-target drug with significant advantages [22, 29]. Berberine administered orally enters the blood after a structural transformation by nitroreductases from bacteria in the gut [30]. However, the bioavailability of Berberine is poor and a large portion of it (over 90%) remains in the intestines [31, 32]. Recent studies have shown that Berberine might modulate the composition of the intestinal bacterial community [33], suggesting that the intestinal microbiota might also be involved in its regulation of energy metabolism.

In this study, we show that Berberine enriched butyrate-producing bacteria in the gut microbiota, and through the acetyl CoA-butyryl CoA-butyrate pathway Berberine promotes the gut microbiota to synthesize butyrate, which then enters the blood and causes a reduction in blood lipid and glucose levels. This mode of action—that is, working through the gut microbiota—appeared to be independent of the direct cellular mechanism of Berberine. We, therefore, speculated that regulating the production of bioactive metabolites in the gut microbiota might be a novel treatment strategy.

2. Materials and Methods
2.1. Chemicals and reagents
Berberine, butyric acid, sodium butyrate, valeric acid, isovaleric acid, and acetone were obtained from the J&K Scientific Ltd. (Beijing, China). Propionate acid, sodium propionate, acetic acid, and isobutyric acid were from the Sigma-Aldrich Co. (Shanghai, China). Tetrahydropalmatine (the internal standard) was purchased from the National Institute for Food and Drug Control (Beijing, China). The purity of the above standards was all over 98% in HPLC. Other chemical reagents from the Sinopharm Chemical Reagent Co., Ltd. (Beijing, China) were all at chromatographic grade purity.
Total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and fasting blood glucose (FBG) detection kits were obtained from the BioSino 7

Bio-technology & Science Inc. (Beijing, China). The ATP and NAD+/NADH assay kits were purchased from the BioAssay Systems (Hayward, CA, USA), and the rat AMP ELISA kit was obtained from the TSZ biological Trade Co., Ltd. (North Brunswick, NJ, USA). Acetyl-CoA and butyryl-CoA were both purchased from the Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China).
Cefadroxil was purchased from the National Institute for Food and Drug Control (Beijing, China). Terramycin and erythromycin were from the J&K Scientific Ltd (Beijing, China).

2.2. Animals
Sprague–Dawley (SD) rats (180–200 g, male) and hamsters (140–160 g, male) were supplied by the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences (Beijing, China). The ob/ob mice (40–50 g) were obtained from the Beijing HFK Bioscience Co. Ltd. (Beijing, China). Animals were housed in SPF-grade rooms and had free access to food and water, with a 12 h light/dark cycle (light on from 8:00 AM to 8:00 PM) at ambient temperature (22–24 C) and 45% relative humidity.
The research was conducted in accordance with institutional guidelines and ethics and approved by the Laboratories Institutional Animal Care and Use Committee of the Chinese Academy of Medical Sciences and Peking Union Medical College.
2.3. Instruments

Liquid chromatography with tandem mass spectrometry (LC-MS/MS 8050, Shimadzu Corporation, Kyoto, Japan) was used for the analysis and quantification of Berberine and its metabolites in biological samples. LC separation was achieved using a Shim-pack XR-ODS II column (75 mm × 3 mm × 2.3 μm, Shimadzu Corporation, Kyoto, Japan) maintained at 40 

C. The mobile phase consisted of water-formic acid (100:0.5, v/v) and acetonitrile with a linear gradient elution (0 min, 90:10; 3.5 min, 75:25; 5.0 min, 70:30; 5.01 min, 80:20; 6.0 min, 90:10) at a flow rate of 0.4 mL/min during the entire gradient cycle. Shimadzu LCMS solution (Version 5.72) was used for data acquisition and processing. For positive ESI analysis, the parameters were as follows: nebulizer gas, 3 L/min; drying gas, 10.0 L/min; interface, -4.5 kV; CID gas, 230 kPa; DL temperature and heat block temperature were maintained at 250 and 400 C, respectively. The quantification was carried out using multiple reaction monitoring modes (MRM). The m/z transitions were 335.8→320.0 (m/z) for Berberine, and 356.0→192.0 (m/z) for the internal standard (IS).

The peak areas of Berberine in fluid samples and the internal standard were recorded respectively. LC-MS/MS was also used for the analysis of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA. The m/z transitions were 810.5→303.5 (m/z) for acetyl-CoA, 851.6→345.2 (m/z) for acetoacetyl-CoA, 853.6→347.2 (m/z) for β-hydroxyl butyryl-CoA, 835.6→329.2 (m/z) for crotonyl-CoA, and 837.6→331.2 (m/z) for butyryl-CoA.
GC-2014 (Shimadzu Cooperation, Kyoto, Japan) was applied to analyze and quantify SCFAs. It was equipped with a flame ionization detector and an Alltech capillary column (AT-WAX, 30 m × 0.25 mm × 0.25 μm, Alltech company, ME, USA) operated in the splitless mode. The helium carrier flow was 37.0 cm/s under a column head pressure of 68.0 kPa. The oven temperature was initially 80 C for 1 min, which was gradually increased to 130 C at a rate of 5 C/min and maintained for 5 min. The injector and detector temperatures were set at 230 C and 250 C, respectively.

2.4. Berberine-mediated butyrate production in intestinal bacteria of the SD rats
A series of butyrate working solutions were prepared at concentrations of 1, 2, 10, 20, 200, and 500 μg/mL by diluting the stock solution (1 mg/mL) with purified water. Then, 50 μL of these solutions were further diluted with 50 μL of acetone. An aliquot of 1 μL of the solutions was injected into the GC-2014 for analysis and a standard curve of butyrate was subsequently created.

Colon contents from six SD rats were pooled, and 2 g of the mixture of colon contents was transferred into a flask containing 40 mL normal saline. After mixing thoroughly, the cultures were pre-incubated under anaerobic conditions with a N2 atmosphere at 37 C for 60 min. Berberine (10 μL) at different concentrations was added to the rat intestinal bacteria cultures (990 μL), with saline (10 μL) as a negative control. The final concentrations of Berberine in the incubation system were 10 and 20 g/mL, respectively. The cultures were incubated for 6, 12, and 24 h at 37

C. At the same time, an equal amount of intestinal bacteria was inactivated through boiling. After termination of the reaction with acetonitrile (1 mL), the incubation was mixed for 30 s and centrifuged at 14,800 rpm for 10 min. The supernatant (100 μL) was transferred into an Eppendorf tube with 100 μL of acetone and centrifuged at 10,000 rpm for 5 min after mixing thoroughly. An aliquot of 1 μL supernatant was injected into the GC-2014 for butyrate analysis.

2.5. Butyrate production by Berberine in intestinal bacteria strains in vitro
Eight intestinal facultative anaerobes were incubated under anaerobic conditions with Berberine at a final concentration of 10 μg/mL for 24 h, including Enterococcus faecium (E. faecium) ATCC 35667, Enterococcus faecalis (E. faecalis) ATCC 29212, Escherichia coli (E. coli) ATCC 25922, Bifidobacterium longum (B. longum) ATCC 15707, Bifidobacterium breve (B. breve) ATCC 15700, Lactobacillus acidophilus (L. acidophilus) ATCC 4356, Lactobacillus casei (L. casei) ATCC 334, and Clostridium butyricum (C. butyricum) ATCC 19398 from Guangdong Huankai Microbial Sci,. & Tech. Co., Ltd. (Guangdong, China). The sample processing procedures were identical to those previously mentioned. Butyrate was quantitatively analyzed using a GC-2014.

2.6. Hamsters with a high-fat diet
A high-fat diet (HFD) was used to induce hyperlipidemia in hamsters in an SPF-grade room. The HFD was made of 1.0% cholesterol, 1.0% sodium cholate, 10.0% lard, 5.0% yolk powder, and 0.2% propylthiouracil added to the standard forage. All of the healthy hamsters were fasted overnight before the experiment.

Based on their weights and their serum TC levels, the 42 hamsters were divided into two groups. The first group was a control group (8 hamsters) and the second was the HFD group (34 hamsters). The control group was given a standard diet. Both groups were free to drink water ad libitum. During the modeling period, the hamsters were weighed and their plasma TC, TG, and LDL-C values were determined every 2 weeks.

After 6 weeks, the hamsters were fasted for 12 h before blood samples were taken from the orbital venous plexus. Blood TC, TG, and LDL-C were detected using commercial kits. The hamster hyperlipidemia model was established when blood TC, TG, and LDL-C of the HFD hamsters were significantly higher than that of the control hamsters.

Eight healthy and 34 HFD hamsters were divided into 3 groups: 8 healthy hamsters as the control group (Group 1), 8 HFD hamsters as the HFD control group (Group 2), and 26 HFD hamsters treated with Berberine (100 mg/kg/day) as the treatment group (Group 3). Berberine was given orally once a day for 10 days.

On days 3, 5, 7, and 10 post-treatment, fresh feces was collected and blood was taken from the orbital venous plexus for plasma samples. The samples were stored at -80 C before analysis. The fecal solution was prepared by reconstituting feces in saline (1 g:3 mL), followed by centrifugation at 10,000 rpm for 5 min. Then, 50 μL of acetone was added to 50 μL of the plasma or the fecal solution, mixed thoroughly, and centrifuged at 10,000 rpm for 5 min. An aliquot of 1 μL of the supernatant was injected into the GC-2014 for butyrate (or propionate) analysis.

Blood TC, TG, and LDL-C were detected using commercial kits.
At day 10 after Berberine treatment (100 mg/kg/day, oral), the HFD hamsters were killed, and liver samples were taken and stored at -80 C. After thawing, the liver samples were homogenized with saline in a ratio of 1:2 [weight (g): volume (mL)]. Then, 100 μL of acetone was added to 100 μL of the liver homogenate, mixed thoroughly, and centrifuged at 10,000 rpm for 5 min. An aliquot of 1 μL of the supernatant was injected into the GC-2014 for butyrate analysis.

2.7. Ob/ob mice model
Eighteen ob/ob mice were randomly divided into 3 groups: 6 mice were given a low dose of butyrate treatment (200 mg/kg/d, Group 1), 6 were given a high dose of butyrate (400 mg/kg/d, Group 2), and 6 were given the Berberine treatment (100 mg/kg/d, Group 3). The drugs were administered orally and once a day for 10 days. The levels of TC, TG, and FBG in the ob/ob mice were tested before the experiment. On days 3, 7, and 10 post-treatment, feces and blood samples were taken for butyrate analysis, as well as TC, TG, and FBG detection, using the methods described above.
The ob/ob mice were also used for the Berberine intraperitoneal (ip) injection experiment, in which 12 mice were tested for blood glucose and lipid levels before the experiment. The 12 mice were then grouped, with 6 mice orally treated with Berberine (100 mg/kg/day, Group 1) and the other 6 mice ip treated with Berberine (20 mg/kg/day, Group 2). Berberine was given once a day for 10 days. Butyrate, TC, TG, and FBG were measured in the feces and plasma.

 

2.8. Pseudo-germ-free ob/ob mice model
The plasma glucose and lipid levels of ob/ob mice were tested before the experiment. Then, the 32 ob/ob mice were divided into four groups: 8 were untreated (Group 1), 8 were orally administered Berberine (100 mg/kg/day, Group 2), 8 were orally administered antibiotics only (Group 3), and 8 were orally administered both antibiotics and Berberine (100 mg/kg/day, Group 4). The regimen for antibiotics included cefadroxil (100 mg/kg/day), terramycin (300 mg/kg/day), and erythromycin (300 mg/kg/day).

For the treatment protocol, the ob/ob mice in Group 3 and 4 were orally administered antibiotics twice a day for 3 days to achieve pseudo-germ-free (PGF) status. Then, Berberine was given to the mice in Group 2 and 4 once a day for 10 days; simultaneously, antibiotics were continuously given to the mice in Group 3 and 4.
On days 3, 7 and 10 post-treatment, feces were collected for butyrate analysis as described, and blood samples were taken on day 10 to determine the levels of TC, TG, and FBG.

The colon contents of all ob/ob mice were collected on day 10 post-treatment, and the PGF status was confirmed by culturing the fecal samples anaerobically in a nutrient agar culture medium.

2.9. Influence on LDLR and InsR gene expression in human hepatocytes by butyrate
The HL-7702 cells were obtained from the Institute of Biochemistry and Cell Biology (SIBS, Chinese Academy of Science, Shanghai, China). Cells were cultured in RPMI-1640 medium with 10% FBS, 1% nonessential amino acids, and appropriate antibiotics in an atmosphere of 5% CO2 at 37 C. Cells were trypsinized and grown to about 70–80% confluence, then were starved in 0.5% FBS-containing medium for 24 h before the experiment.

Butyrate was dissolved in sterile saline, and Berberine was reconstituted in DMSO. They were then used to treat the cells for 24 h in 0.5% FBS-containing medium, as indicated. After treatment, total cellular RNA was isolated and reversely transcribed into cDNA by a commercially available kit according to the supplier’s protocol (Promega, CA, USA). Quantitative real-time PCR was performed with gene-specific primers, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control.

 

The sequences of the primers are LDLR upstream, aggacggctacagctaccc, LDLR downstream, ctccaggcagatgttcacg; InsR upstream, gctggattattgcctcaaagg, InsR downstream, tgagaatcttcagactcgaatgg; GAPDH upstream, tccactggcgtcttcacc, GAPDH downstream, ggcagagatgatgaccctttt. The reactions were performed in an ABI Prism 7900 High-Throughput Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), as previously described [23]. The comparative threshold cycle (CT) method was used for relative quantification of target gene expression, which was plotted as the fold change of the control.

2.10. Detection of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA
LC-MS/MS was used for the analysis of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, crotonyl-CoA, and butyryl-CoA in the SD intestinal bacteria samples treated with Berberine. The optimized m/z transitions from the mass spectrum were 810.5→303.5 (m/z) for acetyl-CoA, 851.6→345.2 (m/z) for acetoacetyl-CoA, 853.6→347.2 (m/z) for β-hydroxyl butyryl-CoA, 835.6→329.2 (m/z) for crotonyl-CoA, and 837.6→331.2 (m/z) for butyryl-CoA. The fold of control, where the control was normalized as 1, was used to express the change of acetyl-CoA, acetoacetyl-CoA, β-hydroxyl butyryl-CoA, and crotonyl-CoA after Berberine treatment.

The external standard method was adopted for the determination of butyryl-CoA. The stock solution of butyryl-CoA (100 ng/mL) was prepared and stored at 4 C. The working solution was prepared at a series of concentrations of 1, 2, 10, 20, and 50 ng/mL by diluting the stock solution with purified water, from which the standard curve was obtained (r2 > 0.99).
Berberine (at final concentrations of 10 and 20 μg/mL) was incubated with SD intestinal bacteria for 6 or 12 h. Acetonitrile was added to terminate the reactions; the samples were centrifuged at 14,800 rpm for 10 min to obtain the supernatant, which was then dried under a nitrogen flow at room 20-22 C. The residue was dissolved in 100 μL of water and centrifuged at 10,000 rpm for 10 min. Then, the samples were analyzed using the LC-MS/MS 8050.

2.11. ATP, AMP, and NADH/NAD+ ratios in intestinal bacteria
SD intestinal bacteria samples were incubated with Berberine (at final concentrations of 10 and 20 μg/mL) for 6 and 12 h in an anaerobic condition. The treatment was terminated by direct centrifugation at 14,800 rpm for 10 min. Then, the supernatant was stored at 4 C, followed by detection of ATP, AMP, and the ratio of NADH/NAD+. The tests were carried out according to the manufacturer’s instructions in the kits.

2.12. Gene expression of butyrate kinase and butyryl-CoA:acetate-CoA transferase
A quantitative real-time RT-PCR assay method was used to measure the gene expression of butyrate kinase (BUK) and butyryl-CoA:acetate-CoA transferase (BUT). Total RNA was extracted using TRIzol Plus RNA Purification Kit (Invitrogen, CA, USA). A quantitative real-time RT-PCR analysis was performed using the Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems, CA, USA) in an ABI 7500 Fast System.

Briefly, 50 ng of total bacterial RNA was quantified in a 20 μL reaction mixture of the kit. The reaction was carried out with an initial holding (30 min at 48 °C), an initial denaturation (10 min at 95 °C), then 40 cycles of denaturation (15 s at 95 °C), and annealing/elongation (1 min at 50 °C for BUK; 1 min at 45 °C for BUT).

2.13. Bacterial composition analysis
The 16S rRNA genes were amplified using the specific primer of 16S V3-V4: 340F-805R to target the V3-V4 regions of 16S rRNA. PCR products were mixed in equidensity ratios. Then, a mixture of PCR products was purified with a GeneJET Gel Extraction Kit (QIAGEN, Germany). Sequencing libraries were generated by using a NEXTflex Rapid Illumina DNA-seq Kit from New England Biolabs (Ipswich, MA, USA) following manufacturer’s recommendations and adding index codes. The library quality was assessed on a Qubit 2.0 Fluorometer (Thermo Scientific, Carlsbad, CA, USA) and Agilent Bioanalyzer 2100 system (Agilent Technologies, USA).

Finally, the library was sequenced on a HiSeq2500 (Illumina) platform and 250 bp paired-end reads were generated. Sequences were analyzed using the Quantitative Insights Into Microbial Ecology (QIIME) software package. First, the QIIME quality filters categorized the reads. Then, we picked a representative sequence for each operational taxonomic unit (OTU) and used the ribosomal database project classifier to annotate taxonomic information for each representative sequence. Sequences with ≥97% similarity were assigned to the same OTUs.

2.14. Data analysis
Statistical analyses were conducted using a two-way ANOVA and Student’s t-test with GraphPad Prism Version 5 (GraphPad Software, La Jolla, CA, USA). The data are expressed as means ± standard deviation. P values less than 0.05 were considered statistically significant.

3. Results
3.1. Berberine treatment increased butyrate production in intestinal bacteria
SD rat intestinal bacteria (as feces) were collected for an in vitro anaerobic incubation in the presence or absence of Berberine. As shown in Fig. 2A, treating intestinal bacteria with Berberine caused an increased production of butyrate in a dose-dependent manner. The earliest significant increase of butyrate was seen 6 h after Berberine treatment (20 μg/mL) and the elevation remained stable for at least another 18 h (Fig. 2A).

 

Heat inactivation of the bacteria abolished the effect of Berberine (Fig. 2A, insert), indicating that the bacteria produced butyrate. Then, eight standard strains of intestinal bacteria were individually treated with Berberine under anaerobic conditions to validate its effect on butyrate.

 

As shown in Fig. 2B, six out of the eight strains increased their butyrate production after Berberine treatment for 24 h (10 μg/mL, *P < 0.05 or **P < 0.01), with the highest increase seen in L. acidophilus ATCC 4356 and the lowest in E. coli ATCC 25922.

Further, we carried out the investigation in hamsters. Feeding healthy hamsters a HFD for 6 weeks significantly decreased the butyrate level in their feces and plasma by 24% and 44%, respectively (Fig. 2C); and at the same time, TC, TG, and LDL-C increased in the hamsters (***P < 0.001 for all three; Fig. 2C).

Treating the HFD-hamsters with Berberine (orally, 100 mg/kg/d) for 10 days increased butyrate in their feces and plasma by 1.8- and 2.5-fold (Fig. 2D), respectively, verifying the butyrate-increasing effect of Berberine in vivo. Accordingly, TC, TG, and LDL-C significantly decreased in HFD-hamsters, as compared to that before treatment (Fig. 2D; ***P < 0.001 for all three).
3.2. Increasing butyrate production in the gut microbiota is a newly discovered mechanism of Berberine in reducing blood lipid and glucose levels

To elucidate the role of butyrate, obese ob/ob mice were treated directly with an oral administration of butyrate (sodium), using Berberine as a reference. As shown in Fig. 3A & B, butyrate increased in the feces and blood in a time- and dose-dependent manner, indicating an efficient absorption and excellent bioavailability in vivo. Berberine treatment revealed a positive effect on butyrate production similar to that observed in the HFD-hamsters (Fig. 2C & D). In an inverse correlation with the level of blood butyrate, blood TC, TG, and FBG went down in the ob/ob mice treated with butyrate (Fig. 3C, D, & E). This reduction positively correlated with the dosage of butyrate and the treatment time (Fig. 3C, D, & E), demonstrating the regulatory effect of butyrate on the metabolism of lipids and glucose.

Although the plasma butyrate level in the Berberine-treated ob/ob mice was lower than that in the mice directly treated with butyrate (Fig. 3B, *P < 0.05, day 7 and 10), the lipids and glucose-lowering efficacy of Berberine was, in general, higher than that of direct butyrate treatment (Fig. 3C, **P < 0.01 on day 10; Fig. 3E, **P < 0.01 on day 7 and 10). The results indicate that the butyrate mechanism played a role in lowering blood lipid and glucose levels, in addition to the direct action of the circulated Berberine.

To elucidate the direct effect of Berberine in a bacteria-free condition, we treated the ob/ob mice with ip Berberine. Berberine at 20 mg/kg/d was used for ip injection for 10 days, considering that the oral bioavailability of Berberine was below 10% [31], and oral Berberine (100 mg/kg/d) served as a reference. As shown in Fig. 3F, ip administration of Berberine (20 mg/kg/d) to the mice for 10 days did not increase the level of butyrate in the feces (Fig. 3F) or blood (Fig. 3F), but significantly lowered blood TC, TG, and FBG with an efficacy similar to that of an oral Berberine treatment (100 mg/kg/d; Fig. 3G).

Interestingly, although an oral administration of Berberine (100 mg/kg/d, for 10 days) showed a blood concentration 56% of the ob/ob mice ip treated with Berberine (20 mg/kg/d, for 10 days; Fig. 3G, insert), its therapeutic efficacy was almost equal to that of the ip injection, probably because it caused a significant increase of butyrate in the blood (Fig. 3F; *P < 0.05 on day 7, ***P < 0.001 on day 10).

 

The results indicate that the overall lipid and glucose-lowering effects of orally administered Berberine represent a synergistic effect of at least two mechanisms. The first one correlates to the direct effect of circulated Berberine on cellular targets (such as LDLR, InsR, AMPK, and PCSK9), and the second relates to the Berberine that remains in the intestines and works through the gut microbiota metabolites, such as butyrate. As butyrate did not increase the expression of LDLR and InsR in hepatocytes (Fig. 3H), the two mechanisms appear to operate independently.

We found that body weights of the Berberine-treated ob/ob mice were significantly lower than those of the control mice on day 10 (**P < 0.01). In addition, the food intake of the Berberine-treated ob/ob mice slightly decreased but remained close to that of the control (Fig. S1). The results show an improvement in energy metabolism by Berberine.

3.3. Inhibition of the gut microbiota by antibiotics attenuated the effect of Berberine on butyrate
To further explore the significance of the gut microbiota from the Berberine treatment, antibiotics were used to create PGF ob/ob mice, based on previously described methods [30]. The ob/ob mice were orally pre-treated with antibiotics for 3 days (see Methods), followed by Berberine treatment with or without simultaneous administration of the antibiotics. The day 10 results are shown in Fig. 4.

Intestinal bacteria colony numbers in the PGF ob/ob mice treated with both Berberine and antibiotics were significantly lower than that of ob/ob mice treated with Berberine alone, with bacterial colony numbers reduced by 57% (0.4 logs; Fig. 4A).
Butyrate concentrations in the feces and plasma of the mice were examined.

 

As shown in Fig. 4B, on day 10, the level of butyrate in either feces or the blood of the Berberine-treated mice reduced by more than 30% as a result of antibiotic administration. With respect to the therapeutic efficacy of Berberine on conventional ob/ob mice (with no antibiotics), treating ob/ob mice orally with antibiotics before and during treatment largely decreased the therapeutic efficacy of Berberine on TC by 44% *(1− (100–82)/(100–68))× 100%+, TG by 41% *(1− (100–84)/(100–73))× 100%] and FBG by 46% *(1−(100–81)/(100–65))× 100%] (Fig. 4C, D, & E).

 

It seemed that an oral administration of antibiotics suppressed intestinal bacteria communities, and, accordingly, decreased butyrate production in the intestinal track, leading to a reduced therapeutic efficacy of Berberine on blood lipid and glucose levels. In addition, the antibiotic-induced reduction of Berberine absorption could also be a reason for the decline of the treatment effect [30].

 

Treating ob/ob mice with antibiotics alone for 10 days decreased TG and FBG to some degree in the mice, although the differences between the untreated control and antibiotic-treated group were not statistically significant; antibiotic treatment did not change TC in the ob/ob mice (Fig. 4C, D, & E).

3.4.Berberine upregulated butyrate synthesis and increased the abundance of the butyrate-producing bacteria
Butyrate is one of the main non-gaseous fermentation end products in anaerobic microbial communities. In this metabolic pathway, two molecules of acetyl-CoA are assembled to form acetoacetyl-CoA. After going through the intermediate steps of ß-hydroxybutyryl-CoA and crotonyl-CoA, the acetoacetyl-CoA is converted to
butyryl-CoA, which transforms to butyrate via the phosphotransbutyrylase 23
(PTB)/BUK pathway or the BUT pathway [15, 35]. In the present study, we found that an incubation of the gut microbiota with Berberine for 12 h largely decreased ATP production (***P < 0.001, for both low and high concentrations of Berberine). A significant early decline in ATP was found 6 h after Berberine treatment (20 μg/mL, **P < 0.01, Fig. 5A) as well. Paralleled with the ATP decline was an increase of AMP (Fig. 5A insert). The results were consistent with that of the Berberine found in the mitochondria of mammalian cells [27].

The reduction of ATP increased the expression of PTB/BUK and BUT [16] (Fig. 5B & C), both of which then expedited the transformation from butyryl-CoA to butyrate (Fig. 5D). The upregulatory effect on the expression of BUT and PTB/BUK were evidenced in the C. butyricum treated with Berberine (Fig. 5B insert & 5C insert). It should be mentioned here that as the PTB and BUK utilize one co-operator in transcription [35], the two enzymes were analyzed in the quantitative real time RT-PCR as one unit [34] (see Methods).

 

Although forming butanol is another metabolic direction of butyryl-CoA if the NADH level is high [16], we found butanol levels unchanged in Berberine treatment (Fig. 5E). In fact, Berberine reduced the level of NADH in the intestinal bacteria, with a decline of NADH/NAD+ ratio by 37.8% when Berberine was at 20 μg/mL (Fig. 5F, **P < 0.01). In addition, crotonyl-CoA and butyryl-CoA, the precursors of butyrate, were elevated, respectively, by Berberine (***P < 0.001, in 6 h), and the elevation continued to be significant for 12 h (**P < 0.01, Fig. 5G; Fig. 5H).

The increase of the two butyrate precursors might help the intestinal bacteria to uphold the production of butyrate in the Berberine treatment (Fig. 6A).
Besides the biochemical processes mediated by the bacterial enzymes mentioned above, the intestinal bacterial composition was analyzed. The ob/ob mice were treated orally with Berberine (100 mg/kg/day) for 10 days and their feces sample was taken for the bacterial composition analysis. The barcoded pyrosequencing of the V3 and V4 regions of the 16S rRNA gene showed that Berberine enriched the abundance of butyrate-producing bacteria in mice intestines. The heat-map of the top 50 bacterial genera that exhibited the most substantial change in abundance after exposure to Berberine is shown in Fig. 6B.

 

Of the 50 genera, the abundance of 9 genera increased after Berberine treatment. Seven of the nine genera were able to produce butyrate, including Enterobacter [36], Escherichia−Shigella [37], Incertae sedis [38], Lachnospiraceae FCS020 group [38], Akkermansia [39], Clostridium sensu stricto 1 [40], and Bacteroides [41], with the biggest increase seen in Enterobacter and Escherichia−Shigella (Fig. 6B). As Berberine showed only a minor inhibitory effect on intestinal bacteria in mice on day 10 post-treatment (Fig. 4A), the increased abundance of the butyrate-producing bacteria by Berberine represents a favorable action of the drug on these bacteria.

 

4. Discussion
The physiological role of the microbial-mammalian axis is becoming increasingly attractive. Metabolites from functioning intestinal microbiota, such as SCFAs and vitamins, are part of the organic chemical composition of human blood [42-44] and distributed throughout the organs, contributing to overall well-being [45].

 

The results presented in this study demonstrate that modulating gut microbiota production of butyrate by Berberine increase the level of butyrate in blood, as well as in liver (Fig. S2).
Butyrate is an important member of the SCFA family. The effect of SCFAs in tissues is mainly mediated through the function of its cellular receptors, free fatty acid receptor 2 (FFAR2) or free fatty acid receptor 3 (FFAR3), which are both G protein-coupled receptor (GPCR) proteins [46, 47] on the cell surface. FFAR3 linked with the pertussis toxin-sensitive Gi/o family participates in the SCFA-induced leptin production in adipose tissue, as well as lipid metabolism regulation. Whereas FFAR2 couples with either the Gi/o or pertussis toxin-insensitive Gq family and is involved in inflammation, glucagon-like peptide 1 (GLP-1) secretion, and body energy regulation [47-49].

In fact, Gao et al. showed that butyrate treatment could prevent obesity and insulin resistance, and the mechanism is related to promotion of energy expenditure and induction of mitochondrial function [50]. Clinical studies have shown that oral Berberine treatment increased insulin sensitivity and glucose disposal rates in patients with type 2 diabetes [18, 20].

Besides butyrate, Berberine treatment stimulated the gut microbiota to produce propionate as well (Fig. 1A), which entered the blood (Fig. S3) and showed bioactivities similar to that of butyrate [2]. The Berberine-induced metabolite profile of the gut microbiota is now under investigation in our laboratory. The functional metabolites from the gut microbiota could be considered drug messengers that enter the blood and exert the therapeutic effects of the original drugs that are poorly absorbed in the intestines, for instance, Berberine.

The increased abundance of butyrate-producing bacteria could be a reason for the elevation in butyrate production. One of the possible explanations is that Berberine might have a selective influence on some of the intestinal bacteria [33]; however, the detailed underlying mechanism remains unclear. As the elevated level of butyrate was verified in individual bacterial strains treated with Berberine in vitro, we were curious about the biochemical mechanism and found the PTB/BUK and BUT enzymes important in upregulating butyrate production.

Although bacterial PTB/BUK and BUT enzymes seemed to be involved in the mechanism, a gene knockout experiment was not performed in the present study. This is because it has been reported that PTB/BUK gene knockout mutants showed no decrease in butyrate production in C. tyrobutyricum [51], as butyrate is an end product of the energy metabolism network in bacteria (Fig. 6A). Therefore, the molecular mechanisms involved in Berberine-mediated increase of butyrate in bacteria need further investigation.

Although the presented work investigates the role of the gut microbiota in the mode of action of Berberine, the finding is of particular significance to herbal medicines, because herbal chemicals are often poorly absorbed in the intestines [52, 53].

Herbal derivatives such as glycosides, alkaloids, flavonoids, and polysaccharides have been investigated for decades and have been reported to be active for certain diseases in patients (or in animals) via oral administration [17, 54-56].

However, the intestinal absorption rates for many of the phytochemicals are very poor and their blood and organ concentrations are low [31, 57-59], raising questions on their therapeutic efficacy observed in patients. The phenomena could not be explained by the current theory of oral drug bioavailability, which was established fundamentally on the evaluation of drug absorption through the intestines [60].

The therapeutic effect of the functional metabolites from the gut microbiota could be a sound justification for the discrepancy. In addition, as the composition of the gut microbiota differs from patient to patient, the clinical efficacy of drugs might be different.

It suggests that the interaction between drug and the gut microbiota might be considered as part of the investigation on personalized medicine. In fact, genetic background, antimicrobials, diet, and physical exercise modulate the composition of intestinal bacteria [30, 61, 62] and, therefore, might influence the therapeutic efficacy of orally administered botanical chemicals poorly absorbed in the intestines.

In the view of drug discovery, orally administrated drugs, which are poorly absorbed and work through bacterial functional metabolites, might be attractive. First, these drugs might have a decreased chance of causing adverse effects in patients, as they hardly enter the blood circulation.

Second, drug stability in the blood, structural modification by hepatic CYP450, and tissue accumulation, which are often significant concerns for chemical drugs, do not seem to be critical for the drugs working through the gut microbiota.

Through anaerobic fermentation, intestinal microbiota could produce various metabolites that are of great potential in pharmacology, such as SCFAs [10, 43], making the gut microbiota a built-in factory synthesizing drug-like substances.

Discovering bioactive metabolites from the gut microbiota and understanding the control of their production in bacterial fermentation might open a new avenue in drug development.

Nicotinamide mononucleotide inhibits JNK activation to reverse Alzheimer disease.

Study published here

Highlights

  •   NMN improved behavioral measures of cognitive impairments in AD-Tg mice.
  •   NMN decreased β-amyloid production, amyloid plaque burden, synaptic loss, and inflammatory responses in AD-Tg mice.
  •   NMN reduced JNK activation in AD-Tg mice.
  •   NMN regulated the expression of APP cleavage secretase in AD-Tg mice.

Abstract

Amyloid-β (Aβ) oligomers have been accepted as major neurotoxic agents in the therapy of Alzheimer’s disease (AD). It has been shown that the activity of nicotinamide adenine dinucleotide (NAD+) is related with the decline of Aβ toxicity in AD. Nicotinamide mononucleotide (NMN), the important precursor of NAD+, is produced during the reaction of nicotinamide phosphoribosyl transferase (Nampt). This study aimed to figure out the potential therapeutic effects of NMN and its underlying mechanisms in APPswe/PS1dE9 (AD-Tg) mice. We found that NMN gave rise to a substantial improvement in behavioral measures of cognitive impairments compared to control AD-Tg mice. In addition, NMN treatment significantly decreased β-amyloid production, amyloid plaque burden, synaptic loss, and inflammatory responses in transgenic animals. Mechanistically, NMN effectively controlled JNK activation. Furthermore, NMN potently progressed nonamyloidogenic amyloid precursor protein (APP) and suppressed amyloidogenic APP by mediating the expression of APP cleavage secretase in AD- Tg mice. Based on our findings, it was suggested that NMN substantially decreases multiple AD- associated pathological characteristically at least partially by the inhibition of JNK activation.

Introduction

As a chronic neurodegenerative disorder, Alzheimer’s disease (AD) is clinically featured by progressive pattern of cognitive deficits and memory impairment. Disturbed energy metabolism in the brain and oxidative stress are two potential factors leading to neural degeneration and cognitive impairments [1]. Aβ oligomers are found to be associated with the pathology of AD [2]. Recent studies indicates that Aβ oligomers inhibit synaptic transmission prior to neuronal cell death [3] and LTP (long-term potentiation), an experimental model for synaptic plasticity and memory [4]. In addition, Aβ oligomers are also found to be relevant to the producing of the free oxygen radical. So far, there is no curative treatment for AD [5]. Considering the varied and well-defined pathologies of AD, new therapies with the functions of reducing pathologies are needed to prevent or slow disease progression.

Nicotinamide adenine dinucleotide (NAD), oxidized (NAD+) or reduced (NADH), plays a key role in many metabolic reactions, for both forms of NAD regulate transfer of hydrogens metabolic reactions, oxidative or reductive [6], as well as mitochondrial morphological dynamics in brain [7]. Among these two forms, oxidized NAD is particularly important to mitochondrial enzyme reactions and cellular energy metabolism [8, 9]. In normal conditions, as people ages, the level of NAD+ drops [6], inhibiting cellular respiration and further causing decreased mitochondrial ATP and possibly cellular death. NAD+ serves a substrate for enzymes that depend on NAD+, such as ADP-ribosyl cyclase (CD38), poly(ADP-ribose) polymerase 1 (PARP1), and Sirtuin 1 (SIRT1) [10].

To treat neurodegenerative diseases, NAD+ depletion and cellular energy deficits need to be prevented for protecting nerves [10]. There are four pathways synthesizing NAD+ in mammals. The salvage pathway (primary route) way is to use nicotinamide, nicotinic acid, nicotinamide riboside, or the de novo pathway with tryptophan [11]. As an essential precursor of NAD+, Nicotinamide mononucleotide (NMN) is produced during the reaction of nicotinamide phosphoribosyltransferase (Nampt). Nampt is essential to regulating NAD+ synthesis [12], for it stimulates phosphoribosyl components to separate from phosphoribosyl pyrophosphates and to combine with nicotinamides. In this way, NMN is generated and with NMN adenylyltransferase, NMN is converted to NAD+. However, the potential therapeutic effects of NMN on AD remain unclear.

c-Jun N-terminal kinases (JNKs) are a family of protein kinases that play a central role in stress signaling pathways implicated in gene expression, neuronal plasticity, regeneration, cell death, and regulation of cellular senescence [13]. Activation of JNK has been identified as a key element responsible for the regulation of apoptosis signals and therefore, it is critical for pathological cell death associated with neurodegenerative diseases and, among them, with Alzheimer’s disease (AD) [14].

As suggested, NAD+ may be essential to brain metabolism and might influence memory and learning. According to recent studies, the stimulation of NAD level is relevant to the reduced amyloid toxicity in AD animal models [15]. Therefore, in this study, the potential therapeutic effects of NMN and the mechanisms of its action regulated in JNK in APPswe/PS1dE9 mice with AD were investigated.

Materials and Methods

Animals

The Institutional Animal Experiment Committee of Tongji University, China, approved all procedures conforming to the Animals’ Use and Care Policies. APPswe/PS1dE9 transgenic mice (6 months old) were purchased from Beijing Bio-technology, China. All animals were maintained in an environment that was pathogen-free. During the experimental period, water and food were accessible to all mice, and the body weight of mice and the intake of food and water were identified at the beginning of the study and then on a weekly basis. In addition, all mice that receive the treatment were observed for their general health. APPswe/PS1dE9 transgenic mice (AD-Tg) and their nontransgenic wild-type mice (NTG) were randomly assigned into four groups with six mice in each group, and each type was treated by NMN and vehicle, respectively Subcutaneous adiministration of NMN (100 mg/kg, Sigma N3501) in sterile (Phosphate Buffered Saline) PBS (200 μl) was applied to each mouse of NMN-treated groups every other day for 28 days. Each mouse with vehicle treatment subcutaneously received sterile PBS (200 μl) every other day for 28 days.

Behavioral Tests

Behavioral tests were carried out by 2 experimenters who were blinded to the treatments twelve weeks after the treatments.

Memory and spatial learning test

To evaluate the memory and spatial learning of all animals, a Morris water navigation task was performed as described previously [16]. Generally, a tracking system (Water 2020; HVS Image, Hampton, UK) was utilized to monitor the trajectory of all mice. During the training trials, a platform with the diameter of 5cm was hidden 1.5 cm below the surface of water and maintained at the same quadrant. In every trial, all mice had at most 1 minute to find the hidden platform and climb onto it. If one mouse cannot find the platform within 1 minute, the experimenters would manually guide the mouse to the platform and kept it there for 10 seconds. The trial was carried out 4 times daily for 6 days. The escape latency referring to the time that a mouse spent in finding the platform is considered as spatial learning score. Following the last training trial, the probe trial was carried out for spatial memories by allowing animals to take a free swim in the pool with the platform removed for 1 minute (swim speeds are equal). The time that each animal took to reach the previously platform-contained quadrant was measured for spatial memories.

Measurement of Passive Avoidance

To assess contextual memories, passive avoidance test was carried out, which was described in the previous studies [17]. Briefly speaking, a two-compartment apparatus with one brightly lit and one dimly lit was used. During the training trial, the animal was put into the light lit compartment. After 60 seconds, the door between the two compartments was opened. The acquisition latency refers to the first latency time of mice to ran into the dimly lit compartment. After coming into the lit compartment, mice were exposed to a mild foot shock (0.3mA) for 3 seconds with the door closed. After 5 seconds, the animals were taken out of the compartment. One day later after the acquisition trial, the mice underwent a retention test. Like in the acquisition test, the latency to go into the dark compartment without foot shock was regarded as retention latency to test retention memory. Longer latency indicates better retention.

Tissue Preparation

Following the two behavioral tests, 24 mice were first anesthetized and then infused with icy normal saline in a transcardial way. The brains were taken out and cut into 2 hemibrains along the midsagittal plane. One of the hemispheres was kept in PBS with 4% paraformaldehyde. Following the xylene treatment, the other fixed hemisphere was maintained in the paraffin for immunohistochemical tests. Then the cerebral cortex and the hippocampus were separated quickly from the hemisphere on the ice. For biochemical tests, they were maintained at −80°C following the separation. The hippocampus, brain cortex, and as well as the whole brain were weighed, respectively.

Immunohistochemistry

Immunohistochemical staining was carried out as described [16]. Briefly speaking, 10 μm brain slices were deparaffinized and rehydrated. To retrieve antigens, proteinase K (200μg/ml) was treated for the staining of Aβ, and sodium citrate (0.01M, pH 6.0) was for the staining of microglia and astrocyte. Sections were blocked through incubation with fetal bovine serum (2%) and Triton X-100 (0.1%) for nonspecific binding. For immunohistochemical analysis, the section was incubated at 4°C for a night with anti-Aβ1-16 monoclonal antibody (1:600; Cell Signaling Technology, Massachusetts, USA) and monoclonal antibody anti-Iba1 (1:1,000; Osaka Wako Pure Chemical Industries, Japan) for rabbits and also monoclonal anti-Aβ antibody (1:200; Billerica, MA) for mouse.

Olympus (Tokyo, Japan) microscope with a connection to a digital microscope camera was applied to capture the images for quantitative analyses. The plaques in μm2s and the proportion of area kept by plaques positive to Aβ1–16 respectively, microglia positive to Iba1 were obtained with imaging software (Bethesda Media Cybernetics, MD). The mean value of every parameter was obtained from 6 sections with an equidistant interval of 150μm through the hippocampal region of each mouse in all groups. All measurements were blindedly conducted.

Enzyme-Linked Immunosorbent Assay (ELISA)

As described before, soluble Aβ fractions and insoluble ones were obtained from both the cortex and hippocampi of brain homogenates of mouse using RIPA (Radioimmunoprecipitation assay buffer) buffer and formic acid, respectively [18]. The levels of both the insoluble and soluble Aβ were identified using the ELISA kits (Camarillo Invitrogen, CA). Besides, concentrations of oligomeric Aβ of brain homogenates treated with RIPA were obtained employing an ELISA kit for amyloid β oligomer (Gunma Immuno-Biochemical Laboratories, Japan).

Proinflammatory Cytokines Measurement

As described, mouse brain proinflammatory cytokine was evaluated [19]. The expressions of TNFα, IL-6, and IL-1β were identified with immunoassay kits (Minneapolis R&D Systems, Minnesota, USA) which is for measuring these factors in mouse.

Western blotting (WB) analysis

The cortex and hippocampus tissue was homogenized with icy PBS and the lysate was for Western blot. At first SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis) was applied to divide the proteins on NuPage Bis-Tris gel (12%, Invitrogen). The separated protein was subsequently transferred to nitrocellulose membrane which was blocked with 5% nonfat milk and probed overnight at 4°C with anti-p-JNK, anti-JNK, anti-APP, anti-sAPPα, anti- sAPPβ, anti-phosphorylated APP (p-APP, Thr668), anti-ADAM10, anti-BACE1 (CA Santa

Cruz Biotechnology, USA), anti-CDK5, anti–p-CDK5, anti–p-GSK3β, anti-GSK3β, anti-SYP, anti–postsynaptic density-95, anti–β-actin Abcam (Cambridge, MA, USA). The membrane was cleaned with TBS/0.05% Tween-20 and incubated at room temperature with secondary antibodies conjugated with horseradish peroxidase for 60 minutes, following incubation with primary antibodies. Enhanced chemiluminescence reagents (Pierce, Rockford, IL, USA) were used for detecting signals.

Statistical Analysis

The data were expressed as mean ± SD. The comparisons in the speed of swimming and escape latency between the groups during the test of memory and spatial learning were made employing two-way ANOVA with repeated measures. Next, post hoc least significant difference (LSD) test was used for multiple comparison. Before post hoc LSD test or Student t test, 1-way ANOVA was employed for the rest data. Statistical analyses were carried out with Prism version 5. A P < 0.05 was considered statistically significant.

Results

NMN Treatment Rescues Cognitive impairments in AD-Tg Mice

The test of memory and spatial learning has shown that 1-year-old AD-Tg mice have experienced impairment in memory and spatial learning [16]. In our study, comparied to the vehicle-/NMN-treated wild-type (WT) mice, the vehicle-treated AD-Tg mice had a longer escape latency, which showed severe impairment of spatial learning in the test (Fig. 1A). However, with shorter escape latency, NMN treatment greatly improved the impairment of spatial learning in vehicle-treated AD-Tg animals (Fig. 1A). Besides, it was also identified that compared with two wild-type groups, vehicle-treated AD-Tg animals spent less time in the target quadrant during the probe trial (p < 0.01), suggesting severe spatial memory impairment. AD-Tg mice treated with NMN spent longer time in the target quadrant, which indicates marked alleviation of the spatial learning impairments present in AD-Tg mice treated with vehicle (p<0.01) (Fig. 1B).

To further identify the alleviation of memory deficits by NMN treatment in AD-Tg mouse, contextual memories were evaluated employing the measurement of passive avoidance [17]. As illustrated in Fig. 1C, retention latency was decreased compared with two wild-type mice groups (p < 0.01), suggesting impaired contextual memories in the AD-Tg animals treated by vehicle. In contrast, NMN-treated mice exhibited longer retention latency compared with those treated with vehicles (p < 0.01), demonstrating outstanding reversal of NMN in contextual memories. All these data indicate that NMN treatment markedly improves cognitive impairments in AD-Tg animals.

NMN Suppresses JNK Phosphorylation in AD-Tg Mice

JNK, also called a protein kinase activated by stress, is said to play a role in a couple of pathophysiological processes in AD [13]. Therefore, in this study, we tested the inhibitory effects of NMN on the activation of JNK through Western blotting. It was revealed by quantitative analysis that p-JNK level was significantly grown in hippocampus and cerebral cortex in the vehicle-treated AD-Tg mice when contrasting to two wild-type groups (Fig. 2A; p < 0.01), whereas NMN gave rise to a sharp decline in p-JNK in hippocampus and cerebral cortex with a comparison to the vehicle-treated AD-Tg mice (Fig. 2B; P< 0.01). Both reductions symbolized a reverse to the wild-type level. But the whole expression of JNK kept unchanged in all the 4 groups. Conclusively, all data indicate that NMN treatment has an inhibitory effects on JNK activation in AD-Tg mice.

NMN Treatment Decreases the Level of Aβ and Deposition in AD-Tg Mice

The role of reduced activation of JNK in the changes of the Aβ level and deposition was studied in AD-Tg mice through employing histological and biochemical analyses. As presented in Figs. 3A-D, it was found that NMN-treated AD-Tg mice had a sharp reduction in the levels of Aβ when comparing to the vehicle treatment group (p < 0.01). Comparing to the vehicle treatment group, NMN treatment gave rise to a marked decrease in Aβ oligomers (p < 0.01) (Fig. 3E). Immunohistochemical staining identified this observation, indicating the lessened diffuse plaques and also the shrinked area taken by diffuse plaques in AD-Tg mice treated by NMN compared to the vehicle treatment group (Figs. 4A-D). Thus, on the basis of the findings, it was demonstrated that the generation of Aβ in the brain of AD-Tg mice is effectively decreased by the inhibited activation of JNK with NMN treatment.

NMN Treatment Changes the Processing of APP in AD-Tg Mice

To study the mechanism of inhibition on the production of Aβ and deposition, the effects of NMN on the processing of APP were examined by Western blotting. As presented in Figs. 5A-C, the level of full-length APP expression was greatly increased in the brain of AD-Tg mouse treated with vehicle compared with wild-type ones (p < 0.01). However, they kept unaltered between the group treated with vehicle and that with NMN. Importantly, it was found that NMN treatment remarkably lowered the increased levels of p-APP in the AD-Tg mice treated by vehicle (p < 0.01). Besides, α-secretase cleaved sAPPα and β-secretase cleaved sAPPβ in the brain tissues of Tg mice were tested via Western blotting. It was shown by quantitative analyses that NMN treatment led to a remarkable elevation of sAPPα (p < 0.01) and a marked decline in sAPPβ (p < 0.01) compared with the transgenic mice treated by vehicle (Figs. 5D-F). Based on these data, it was indicated that NMN treatment is strongly effective in suppressing the phosphorylation of APP, improving cleaving of APP by α-secretase, and decreasing the cleaving of APP by β-secretase in AD-Tg mice brains.

NMN Treatment Improves Inflammatory Responses in AD-Tg Mice

Since JNK activation is indicated to play a role in the inflammatory response induced by Aβ in previous studies [20], whether reduced activation of JNK influences neural inflammation in AD- Tg animals was investigated. The role of NMN on the neural inflammation was identified by measuring proinflammatory cytokines that were in the lysates of cortical tissues. It was found that the level of IL-6, IL-1β, and TNFα were sharply declined in the AD-Tg mice treated by NMN relative to those by vehicle (Figs. 6A-C). According to these findings, NMN treatment is indicated to be potently effective in the amelioration of neural inflammation in AD-Tg mice brains.

NMN Treatment Ameliorates Synaptic Loss in AD-Tg Mice

The loss of synapse is an important pathological characteristic of AD and said to be relevant to the cognitive impairments of AD [21]. The changes in SYP (presynaptic marker) level and PSD- 95 level (postsynaptic marker) were investigated via Western blotting. It was showed by quantitative analysis that SYP levels and the levels of PSD-95 expression substantially reduced in hippocampus and brain cortex of AD-Tg mice treated with vehicle relative to WT ones

(p < 0.01), whereas NMN treatment significantly elevated SYP levels and the levels of PSD-95 expression in hippocampus and brain cortex relative to AD-Tg mice treated with vehicle (p < 0.01) (Fig. 6D-F). This finding suggest that NMN treatment sharply ameliorates the loss of synapse in AD-Tg mice brains.

Discussion

In the present study, it is mainly found that NMN treatment substantially improves primary pathological characteristics of the AD-modeled AD-Tg mice, including cognitive impairments, neuroinflammation, Aβ pathology, and synaptic loss, which consistent with a recent study [22]. It was also found that NMN treatment inhibited JNK activation and amyloidogenic processing of APP by mediating the expression of APP-cleavage secretase, and also facilitated APP processing in AD-Tg mice. The data prove that NMN treatment greatly reduces multiple AD-associated pathological characteristics, at least partially by the inhibition of JNK activation.

Numerous studies have reported the increase of abnormal activation of JNK in both the transgenic AD mice models and the AD patients [23-25]. Conforming to the above previous studies, we also found that the level of phosphorylated JNK in AD-Tg mice treated by vehicle was higher than that in the wild-type group, but NMN treatment in AD-Tg mice potently suppressed the phosphorylation of JNK to the basic level of WT groups. The controlled activation of JNK through NMN gave rise to a substantial decrease of Aβ pathology in AD-Tg animals. According to the studies before, active JNK is proved to engage in BACE1 expressions and PS1 expressions [26, 27]. In addition, the increased BACE1 and PS1 in AD-Tg mice treated by vehicle were found to be greatly suppressed by NMN to the basic level of WT groups (data not shown). More interestingly, it was also observed that NMN treatment led to substantially elevated sAPPα and reduced sAPPβ. It was notable that according to the previous studies, APP phosphorylation at the site of Thr668 is proved to promote the β-secretase cleavage of APP to grow Aβ generation in vitro [28]. In present study, we also found that the administration of NMN in AD-Tg mice significantly declined the elevated phosphorylation of APP to the primary level of WT controls, indicating an in vivo inhibition mechanism of Aβ pathology through NMN treatment. Collectively, all these findings indicate that the potent effects of NMN on the marked decrease in Aβ pathology in the brains of AD-Tg mice may be responsible for its enhancement of nonamyloidogenic APP processing. What we found is consistent to a recent study demonstrating that genetic depletion of JNK3 in 5XFAD mice is attributed to a significant decrease in the levels of Aβ and the total plaque loads [29]. Recently numerous studies suggested energy failure and accumulative intracellular waste also play a causal role in the pathogenesis of several neurodegenerative disorders and Alzheimer’s disease (AD) in particular regulated by potential role of several metabolic pathways Wnt signaling, 5′ adenosine monophosphate-activated protein kinase (AMPK), mammalian target of rapamycin (mTOR), Sirtuin 1 (Sirt1, silent mating-type information regulator 2 homolog 1), and peroxisome proliferator-activated receptor gamma co- activator 1-α (PGC-1α) [30, 31]. It will be warrant to study if NMN also participate in regulation of these signaling pathways.

Some recent studies indicate that enhanced neuroinflammation is essential to the development of AD [32-34]. In our study, a marked decline in the proinflammatory cytokines levels (IL-6, IL-1β, and TNFα) proved that NMN treatment effectively controlled the neuroinflammatory responses of the brain of AD-Tg mouse. Considering the key role of oligomeric and fibrillar Aβ for activation of microglia cells and astrocytes with the subsequent generation of proinflammatory cytokines [34], the reduction in neuroinflammatory responses may be less important to the substantial reduction in Aβ pathologies presented in the AD-Tg mice treated by NMN. Several previous studies had proved that JNK represents an important mediator for activation of glial cell and proinflammatory cytokines [35, 36]. Thus, the favorable effects of NMN on lowered inflammatory responses in AD-Tg groups can be largely responsible for its direct control of inflammation by inhibiting JNK activation. Based on the previous reports, it was proved that some proinflammatory cytokines (ie, IL-1β, interferon gamma, and TNFα) may elevate the expression of β-secretase and γ-secretase to ameliorate amyloidogenic APP processing and Amyloid-β production by an in vitro JNK-mediated pathway [33]. Hence, we have reasons to believe that the reduced proinflammatory cytokines through NMN treatment may be effective in reducing the production of Aβ in vivo. Moreover, in our study, it was demonstrated that NMN treatment ameliorates cognitive impairments in AD-Tg mouse models. An increasing evidence has proved that grown Aβ levels, neuroinflammation, synaptic dysfunction and loss are closely related to the cognitive dysfunction in AD [37]. In addition, our data confirms the finding of a recent research, which revealed that genetic down-regulation of JNK3 gives rise to a remarkable amelioration of cognitive impairments in 5XFAD mice [29]. Collectively, our findings, along with all the previous research, demonstrate that the inhibited JNK activaty by NMN is potently effective in ameliorating AD-associated cognitive deficits.

Synaptic loss is a major pathological change of AD and is tightly associated with AD-related cognitive impairments [37]. It was presented that PSD-95, a biomarker of postsynaptic density, is essential to synapse maturation and synaptic plasticity [38], and that SYP, a presynaptic protein, also acts as an integral membrane protein in the synapse and it plays a key role in plasticity of synapses [39]. Therefore, it can be soundly supposed that the greatly lowered expression of PSD- 95 and SYN presented in the study may suggest the impairment of synaptic integrity and  plasticity in AD-Tg mice treated by vehicle. Intriguingly, the treatment of NMN in AD-Tg animals substantially elevated the lowered PSD-95 and SYN expression level back to the primary level of WT controls. Since it was demonstrated by several studies that Amyloid-β- induced synaptic loss and dysfunction are regulated through the JNK activation [40, 41], the possible mechanisms behind NMN treatment leading to the elevated expression of PSD-95 and SYN in AD-Tg animals may be responsible for its inhibitory effects on JNK activation. Thus, it is possible that the treatment of NMN may ameliorate the impaired synaptic plasticity which is caused by toxic Aβ species in AD-Tg mice.

In summary, this study provides essential preclinical evidences that NMN takes effects in reversing cognitive deficits and substantially lowering the burden of amyloid plaque, neuroinflammation, cerebral amyloid-β concentrations, and loss of synapse in middle-aged AD- Tg mice, at least partially by the inhibition of JNK activation. According to our findings, NMN could be a new target for disease-modifying treatments of AD.

References

  1. Kapogiannis, D. and M.P. Mattson, Disrupted energy metabolism and neuronal circuit dysfunction in cognitive impairment and Alzheimer’s disease. Lancet Neurol, 2011. 10(2): p. 187-98.
  2. Gong, Y., et al., Alzheimer’s disease-affected brain: presence of oligomeric A beta ligands (ADDLs) suggests a molecular basis for reversible memory loss. Proc Natl Acad Sci U S A, 2003. 100(18): p. 10417-22.
  3. Hardy, J. and D.J. Selkoe, The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science, 2002. 297(5580): p. 353-6.
  4. Lesne, S., et al., A specific amyloid-beta protein assembly in the brain impairs memory. Nature, 2006. 440(7082): p. 352-7.
  5. Tayeb, H.O., et al., Pharmacotherapies for Alzheimer’s disease: beyond cholinesterase inhibitors. Pharmacol Ther, 2012. 134(1): p. 8-25.
  6. Imai, S. and L. Guarente, NAD+ and sirtuins in aging and disease. Trends Cell Biol, 2014. 24(8): p. 464-71.
  7. Long, A.N., et al., Effect of nicotinamide mononucleotide on brain mitochondrial respiratory deficits in an Alzheimer’s disease-relevant murine model. BMC Neurol, 2015. 15: p. 19.
  8. Kristian, T., et al., Mitochondrial dysfunction and nicotinamide dinucleotide catabolism as mechanisms of cell death and promising targets for neuroprotection. J Neurosci Res, 2011. 89(12): p. 1946-55.
  9. Owens, K., et al., Mitochondrial dysfunction and NAD(+) metabolism alterations in the pathophysiology of acute brain injury. Transl Stroke Res, 2013. 4(6): p. 618-34.
  10. Liu, D., M. Pitta, and M.P. Mattson, Preventing NAD(+) depletion protects neurons against excitotoxicity: bioenergetic effects of mild mitochondrial uncoupling and caloric restriction. Ann N Y Acad Sci, 2008. 1147: p. 275-82.
  11. Yamamoto, T., et al., Nicotinamide mononucleotide, an intermediate of NAD+ synthesis, protects the heart from ischemia and reperfusion. PLoS One, 2014. 9(6): p. e98972.
  12. Imai, S., Dissecting systemic control of metabolism and aging in the NAD World: the importance of SIRT1 and NAMPT-mediated NAD biosynthesis. FEBS Lett, 2011. 585(11): p. 1657-62.
  13. Mehan, S., et al., JNK: a stress-activated protein kinase therapeutic strategies and involvement in Alzheimer’s and various neurodegenerative abnormalities. J Mol Neurosci, 2011. 43(3): p. 376-90.
  14. Yarza, R., et al., c-Jun N-terminal Kinase (JNK) Signaling as a Therapeutic Target for Alzheimer’s Disease. Front Pharmacol, 2015. 6: p. 321.
  15. Kim, D., et al., SIRT1 deacetylase protects against neurodegeneration in models for Alzheimer’s disease and amyotrophic lateral sclerosis. EMBO J, 2007. 26(13): p. 3169- 79.
  16. Zhang, W., et al., Multiple inflammatory pathways are involved in the development and progression of cognitive deficits in APPswe/PS1dE9 mice. Neurobiol Aging, 2012. 33(11): p. 2661-77.
  1. Ishrat, T., et al., Amelioration of cognitive deficits and neurodegeneration by curcumin in rat model of sporadic dementia of Alzheimer’s type (SDAT). Eur Neuropsychopharmacol, 2009. 19(9): p. 636-47.
  2. Li, J.G., et al., Homocysteine exacerbates beta-amyloid pathology, tau pathology, and cognitive deficit in a mouse model of Alzheimer disease with plaques and tangles. Ann Neurol, 2014. 75(6): p. 851-63.
  3. Chu, J. and D. Pratico, Involvement of 5-lipoxygenase activating protein in the amyloidotic phenotype of an Alzheimer’s disease mouse model. J Neuroinflammation, 2012. 9: p. 127.
  4. Vukic, V., et al., Expression of inflammatory genes induced by beta-amyloid peptides in human brain endothelial cells and in Alzheimer’s brain is mediated by the JNK-AP1 signaling pathway. Neurobiol Dis, 2009. 34(1): p. 95-106.
  5. Querfurth, H.W. and F.M. LaFerla, Alzheimer’s disease. N Engl J Med, 2010. 362(4): p. 329-44.
  6. Wang, X., et al., Exendin-4 antagonizes Abeta1-42-induced suppression of long-term potentiation by regulating intracellular calcium homeostasis in rat hippocampal neurons. Brain Res, 2015. 1627: p. 101-8.
  7. Braithwaite, S.P., et al., Inhibition of c-Jun kinase provides neuroprotection in a model of Alzheimer’s disease. Neurobiol Dis, 2010. 39(3): p. 311-7.
  8. Sclip, A., et al., c-Jun N-terminal kinase regulates soluble Abeta oligomers and cognitive impairment in AD mouse model. J Biol Chem, 2011. 286(51): p. 43871-80.
  9. Thakur, A., et al., c-Jun phosphorylation in Alzheimer disease. J Neurosci Res, 2007. 85(8): p. 1668-73.
  10. Guglielmotto, M., et al., Amyloid-beta(4)(2) activates the expression of BACE1 through the JNK pathway. J Alzheimers Dis, 2011. 27(4): p. 871-83.
  11. Rahman, M., et al., Intraperitoneal injection of JNK-specific inhibitor SP600125 inhibits the expression of presenilin-1 and Notch signaling in mouse brain without induction of apoptosis. Brain Res, 2012. 1448: p. 117-28.
  12. Colombo, A., et al., JNK regulates APP cleavage and degradation in a model of Alzheimer’s disease. Neurobiol Dis, 2009. 33(3): p. 518-25.
  13. Yoon, S.O., et al., JNK3 perpetuates metabolic stress induced by Abeta peptides. Neuron, 2012. 75(5): p. 824-37.
  14. Godoy, J.A., et al., Signaling pathway cross talk in Alzheimer’s disease. Cell Commun Signal, 2014. 12: p. 23.
  15. Killick, R., et al., Clusterin regulates beta-amyloid toxicity via Dickkopf-1-driven induction of the wnt-PCP-JNK pathway. Mol Psychiatry, 2014. 19(1): p. 88-98.
  16. Hong, H.S., et al., Interferon gamma stimulates beta-secretase expression and sAPPbeta production in astrocytes. Biochem Biophys Res Commun, 2003. 307(4): p. 922-7.
  17. Liao, Y.F., et al., Tumor necrosis factor-alpha, interleukin-1beta, and interferon-gammastimulate gamma-secretase-mediated cleavage of amyloid precursor protein through aJNK-dependent MAPK pathway. J Biol Chem, 2004. 279(47): p. 49523-32.
  18. Morales, I., et al., Neuroinflammation in the pathogenesis of Alzheimer’s disease. A rational framework for the search of novel therapeutic approaches. Front Cell Neurosci,2014. 8: p. 112.
  19. Kim, S.H., C.J. Smith, and L.J. Van Eldik, Importance of MAPK pathways for microglialpro-inflammatory cytokine IL-1 beta production. Neurobiol Aging, 2004. 25(4): p. 431-9.
  1. Waetzig, V., et al., c-Jun N-terminal kinases (JNKs) mediate pro-inflammatory actions of microglia. Glia, 2005. 50(3): p. 235-46.
  2. Marcello, E., et al., Synaptic dysfunction in Alzheimer’s disease. Adv Exp Med Biol, 2012. 970: p. 573-601.
  3. El-Husseini, A.E., et al., PSD-95 involvement in maturation of excitatory synapses. Science, 2000. 290(5495): p. 1364-8.
  4. Janz, R., et al., Essential roles in synaptic plasticity for synaptogyrin I and synaptophysin I. Neuron, 1999. 24(3): p. 687-700.
  5. Costello, D.A. and C.E. Herron, The role of c-Jun N-terminal kinase in the A beta- mediated impairment of LTP and regulation of synaptic transmission in the hippocampus. Neuropharmacology, 2004. 46(5): p. 655-62.
  6. Sclip, A., et al., c-Jun N-terminal kinase has a key role in Alzheimer disease synaptic dysfunction in vivo. Cell Death Dis, 2014. 5: p. e1019

Artificial Sweeteners in Pregnancy and Obesity in The Child

The use of artificial sweeteners has increased dramatically in recent decades.

At the same time, obesity rates have skyrocketed. However, the link between artificial sweetener use and obesity is controversial.

A new study was just done that examines the use of artificial sweeteners in pregnancy and the risk of obesity in child.

The findings were very interesting, and are outlined below.

Pregnant Woman With Candy Heart

Background

More than 30% of pregnant women may regularly consume artificially sweetened beverages (12).

Animal studies suggest that when unborn offspring are exposed to artificial sweeteners they are more likely to develop overweight or obesity after birth (34).

They also tend to have greater preferences for sweet foods, changed blood lipid profiles and increased insulin resistance (456).

However, until now, this association has never been examined in humans.

Article Reviewed

This study assessed the consumption of artificial sweeteners among pregnant mothers and examined its association with infant body mass index.

Association Between Artificially Sweetened Beverage Consumption During Pregnancy and Infant Body Mass Index

Study Design

This was an observational cohort study examining the link between maternal consumption of artificial sweeteners and infant obesity.

It included 2686 healthy, pregnant women from the Canadian Healthy Infant Longitudinal Development (CHILD) Study.

The dietary intake of these women was estimated using a food frequency questionnaire during the second or third trimester of pregnancy.

One year after birth, the researchers measured the body mass index (BMI) of their children.

Bottom Line: This observational study examined the association of artificial sweetener intake among pregnant mothers and infant body mass index at age one.

Finding: Maternal Consumption of Artificial Sweeteners Was Linked With an Increased Risk of Infant Overweight

More than a quarter of the women in this study consumed artificial sweeteners during pregnancy.

At one year of age, the children of those women who consumed a lot of artificial sweeteners during pregnancy had a higher body mass index (BMI) than those who consumed less.

Additionally, they were twice as likely to be overweight at age one, compared to those who weren’t exposed to artificial sweeteners while still in the womb.

Infants of women who consumed artificially sweetened beverages were 119% more likely to be overweight at 1 year, compared to women who consumed them less than once per month.

When the analysis was done separately for each gender, the researchers found that maternal intake of artificial sweeteners was only linked with body weight in boys. This is supported by a study in mice (5).

These associations remained significant even after adjusting for maternal BMI, diet quality, total calorie intake and other risk factors for obesity.

Bottom Line: The study showed that high intake of artificial sweeteners among pregnant women increased their child’s risk of becoming overweight or obese at age one. However, the association was only significant in boys.

Do Artificial Sweeteners Really Cause Weight Gain?

This was the first human study to suggest that maternal consumption of artificial sweeteners during pregnancy may increase the risk of weight gain and obesity in the infant.

A few observational in humans have also suggested that artificial sweeteners may increase the risk of weight gain and metabolic syndrome in adults (78).

However, these were all observational studies, meaning that they couldn’t demonstrate a cause-and-effect relationship.

Their results have also been inconsistent, with some studies suggesting that artificial sweeteners may reduce the risk of obesity (910).

Additionally, a recent meta-analysis of randomized controlled trials concluded that low-calorie sweeteners reduce calorie intake and body weight. This is discussed in a previous research review.

Bottom Line: Human studies haven’t proved that artificial sweeteners promote weight gain. Observational studies have provided inconsistent results.

How Might Artificial Sweeteners Cause Weight Gain?

Researchers have come up with several ideas of how eating artificial sweeteners could affect body weight in adults.

These include:

  • Changes in glucose metabolism (11).
  • Disruption of the gut microbiota (12).
  • Dysregulation of appetite control and calorie compensation (13).

Since artificial sweeteners have been detected in human breast milk, infants may be exposed to sweeteners consumed by their mothers (14).

Bottom Line: Several theories have been proposed to explain the possible effects of artificial sweeteners on body weight. These involve adverse changes in glucose metabolism or the gut microbiota.

Limitations

The main limitation of this study is its observational design.

Second, the study didn’t distinguish between different types of artificial sweeteners, and didn’t account for the amount found in solid foods.

Third, the researchers assessed the intake of artificial sweeteners using food frequency questionnaires (FFQ). Although they are generally good at differentiating between high and low consumers, FFQs are often inaccurate.

Additionally, the questionnaire used in the present study was not specifically validated for beverages.

Finally, infant overweight and obesity were estimated using BMI, which is an inaccurate measure of body fat.

Bottom Line: The study’s main limitation was its observational design. Measures of artificial sweetener intake and body fat were also inaccurate.

Summary and Real-Life Application

In short, this study suggests that high intake of artificial sweeteners among pregnant women may increase their children’s risk of excessive weight gain and obesity.

However, since the study had an observational design, it couldn’t prove that artificial sweeteners were responsible for the association.

For this reason, the role of artificial sweeteners in infant weight gain and obesity are still unclear. Randomized controlled trials are needed before any hard conclusions can be reached.